HiSeq43 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq43
Unique NameHiSeq43
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length202
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq43 ID=HiSeq43|Name=HiSeq43|organism=Ostrinia scapulalis|type=mRNA|length=202bp
CCAGCGCGAGGAGAGGCGGTGCCACACGCCGCTGCCGTCTGAGGAGTCAT
TGCTCAACTGAAGATAGTTTGAAATCAATAGAAAGAGAGAGAGAGAGATG
TGCATTTAATCACACGCCCTTTCTACCATAAGAGACACAACGAAATCTAT
GGAAAGATATTAGATCTAATACAAACGAGAGAGCCTGGACGCGTGGTTGG
GG
back to top