BAP2ALocus_1000_Transcript_1/2_Confidence_0.667_Length_1144 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1000_Transcript_1/2_Confidence_0.667_Length_1144
Unique NameBAP2ALocus_1000_Transcript_1/2_Confidence_0.667_Length_1144
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length1144
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1000_Transcript_1/2_Confidence_0.667_Length_1144 ID=BAP2ALocus_1000_Transcript_1/2_Confidence_0.667_Length_1144|Name=BAP2ALocus_1000_Transcript_1/2_Confidence_0.667_Length_1144|organism=Venturia canescens|type=mRNA|length=1144bp
CTCAAGCATATCGTAAGACCGTTCAGCGAATTGTCGATAACGAATTTGAT
CGTGTACGTAATCCGTGAAGTTATTAGAAACAAAAGTTGGCGTAAAGTCG
GACAAGAAAAATGTATTATTATGTAAACTTTTCCATCTTTTTCGTTTTCG
TGCTCAAGTTCGTGGGAATTTGTGTTCGATCAAGAATTTCAAGAATGCAA
ATTCAAATCTCAGCATTTGCTATCTAAAAGATTTCTAAAAGAATGAATAT
CTCTGGTCTCTCAAACGGCCAACTCAGGAGCCGCTTAATTTTGATCTCCA
AAACTCGAATTTCGACGAATTCATTGCCCCAAAACGTCTGATCTGCGTTC
AAGATGAGATCGAAGAAGCGAGTTAATTTTGTTATTTTTCTGAACGTCAG
AGACGAGTACGTCTGAATGTATAGTAATGTTGGAGGTAACATTTTTGTCG
ATTGAAAATTTATTTAGCAGCAATCGGTCAGGTAGAGATTCAATACGTAG
GCTTTTGTTTTTGAGAGCTCCAGCAGTGCCACAACAGCAGTTTTGCGCCA
CCAAACAAATTCGGACGTAGTTGGCACTACGTTCAAAATCTCACCATTCT
TTTATCTCGTTTGTTATCTCCGAACTGACTCTAAACAAAGCCGACCGGCA
GAGTGAAACAAACGCGAGTGATTATAGACCTAGTTCGATCAACGATCCTA
TTAGTGCGCGTGCAGTGGAATTTTCACAATCCTACACATATTTTTGTTGT
GATCAAGTGAACTTAAACAGAAGTACAAAACGTCTAAAGGAAATTGACAA
GAAAGAAAGAAAAAAAGTAGTGCGTCGATCATGGATAACAACGAAAAATT
TTGTATTCATGAATATTATGAAAATACCCAATATAAACGCATCCATCTGA
TGCGAGGAATAGTCGCTAACGCTACTAGAGAATCTTTGAACCCATCGCAG
AAACCAGGCTTGACCTTAGAGTTGATAAATTTGAACCTGAGGTTCCTTGA
AGATCTTTACAGGCAGTTCTTGAAAACCCATGAAGAGATGGCGAAATATG
TTCAAACTGCCTGTAAAAGTTACGATTTTTATGGGATCGCTTTTGAAGTC
TACCGGGGCGCGAAAGAAAAACTTATCTGCAATCGTTACGAGGC
back to top