BAP2ALocus_1001_Transcript_2/4_Confidence_0.429_Length_1016 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1001_Transcript_2/4_Confidence_0.429_Length_1016
Unique NameBAP2ALocus_1001_Transcript_2/4_Confidence_0.429_Length_1016
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length1016
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1001_Transcript_2/4_Confidence_0.429_Length_1016 ID=BAP2ALocus_1001_Transcript_2/4_Confidence_0.429_Length_1016|Name=BAP2ALocus_1001_Transcript_2/4_Confidence_0.429_Length_1016|organism=Venturia canescens|type=mRNA|length=1016bp
ACAATTACTGAACATGTACAAAGTTCCGTGTGCTTTGTATTTTTATGTTT
CTTTAAATATAAAAAAACATAAAAATACAAAGCACACGGAACTTTGTACA
TGTTCAGTAATTGTATATATACAGATGTTATACACAATATTTGGACGGAA
TATGCATGTGATGAAGTATCTTCACATATCTCAACTACTATTAGAGGCTA
AAATCATGATTGAAAAATAGGTTTCAGCATCGATTTCTATCGCTATGCAC
TTTTGAAAGTTCACTTTGAAACATACAGAATGTGTTGTCCTTAGATTAGT
AAAACAAAGTTCTCATATTTTATATTATTAAATTTCTTAATCAGTTTTTT
CGGTGTAACCTCGTTATCATAATTGAAGGCTAAATAAAATACAGCACTTC
TGATCGCATTTTGTAAAGGCACTTAGTGACAACAGTGGTGACACATTTGG
TTAGCGATTCCAACCAAGTTTTGGAAATCAATTGAAAATAGCAGCTTCTG
GGTTTTTTCGATCAACCATGAAGCCGCTCTCTTAAAAATAGTTGGTTGAA
CGGTTTTTTAATAAAGAAAAAAAATATCGCGCTCGTATCTCAATCGAGGG
AAATGAGTGATTGATTTTCAGATTCATTATGGTTTTTGAGTATTCAGCCT
TCGTAATTTCCATGGTGGAATGTTTGTCACGTTTGTCAAAAGACTTACGA
ACATGTGCATGTAAGATCTCAATCCTATAATTCCAATACGAACTAAAAAA
TATGCTTAGAAAATTGCCTAAAAAATATGTTTAGAATATTTTTTAGGCAA
ATTGTACAAAAAAAATTACATTACACGAAAATTTTGAACGTTTGCGTCAT
AGTTGTCATCAATTGACAAATAATTTCCAATTGAATTAAAATGCACAATA
TACGAAATTTAATTTTCGGACAATTGGTCTATTTTTTAACAAACTCATTT
GGAAATGTTAAATCTCTCAAAATTTTCGTGTAATGTAATTTTTTTTGTAC
AATTTGCCTAAAAAAT
back to top