BAP2ALocus_1001_Transcript_4/4_Confidence_0.571_Length_3846 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1001_Transcript_4/4_Confidence_0.571_Length_3846
Unique NameBAP2ALocus_1001_Transcript_4/4_Confidence_0.571_Length_3846
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length3846
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1001_Transcript_4/4_Confidence_0.571_Length_3846 ID=BAP2ALocus_1001_Transcript_4/4_Confidence_0.571_Length_3846|Name=BAP2ALocus_1001_Transcript_4/4_Confidence_0.571_Length_3846|organism=Venturia canescens|type=mRNA|length=3846bp
ACAATTACTGAACATGTACAAAGTTCCGTGTGCTTTGTATTTTTATGTTT
CTTTAAATATAAAAAAACATAAAAATACAAAGCACACGGAACTTTGTACA
TGTTCAGTAATTGTATATATACAGATGTTATACACAATATTTGGACGGAA
TATGCATGTGATGAAGTATCTTCACATATCTCAACTACTATTAGAGGCTA
AAATCATGATTGAAAAATAGGTTTCAGCATCGATTTCTATCGCTATGCAC
TTTTGAAAGTTCACTTTGAAACATACAGAATGTGTTGTCCTTAGATTAGT
AAAACAAAGTTCTCATATTTTATATTATTAAATTTCTTAATCAGTTTTTT
CGGTGTAACCTCGTTATCATAATTGAAGGCTAAATAAAATACAGCACTTC
TGATCGCATTTTGTAAAGGCACTTAGTGACAACAGTGGTGACACATTTGG
TTAGCGATTCCAACCAAGTTTTGGAAATCAATTGAAAATAGCAGCTTCTG
GGTTTTTTCGATCAACCATGAAGCCGCTCTCTTAAAAATAGTTGGTTGAA
CGGTTTTTTAATAAAGAAAAAAAATATCGCGCTCGTATCTCAATCGAGGG
AAATGAGTGATTGATTTTCAGATTCATTATGGTTTTTGAGTATTCAGCCT
TCGTAATTTCCATGGTGGAATGTTTGTCACGTTTGTCAAAAGACTTACGA
ACATGTGCATGTAAGATCTCAATCCTATAATTCCAATACGAACTAAAAAA
TATGCTTAGAAAATTGCCTAAAAAATATGTTTAGAATATTTTTTAGGCAA
ATTGTACAAAAAAAATTACATTACACGAAAATTTTGAACGTTTGCGTCAT
AGTTGTCATCAATTGACAAATAATTTCCAATTGAATTAAAATGCACAATA
TACGAAATTTAATTTTCGGACAATTGGTCTATTTTTTAACAAACTCATTT
GGAAATGTTAAATCTCTCAAAATTTCTACGTCTCCTGATGTTTTAAAAAT
TTTTGTGGTATCGCAAGGTCTTAAAATTCTGCCGTACCTACGTATCCACG
AAATATCGCTAAATATAAATTTTGTACAAGCTTACAAATTAAAATTATTA
TTTTCTTGGACGGTTTTTTCTCGGGCTTGATTTAAAACCCGAGGCATAGT
TTCCACGTATATCGGTGGATAACTTATGAGATTTGGATACGCACGAATTT
ATCTGCGTACATAAAAGCGGTAGAAAAGAACTAAAACTGAAAAAACGAGT
ATCCAGCTTGATTGGATGGAAGTTGCGCCGGCTAGACGGCACTTGAACAT
GTCATATCGAGTTTCTACGTCGTTGACGATGTTGTTGAATTCAGCTTCGA
CTATTTGACCATCGTAATACGTGATGGGATCTTCAAACGGATATTCGAAG
CCTTGTTTACATTCGCATTTGTATCCACCGGTTTCGAAACCTCGCCCCAA
AATTGGAACACAGTATGAAGTTTTCCTGTCACACTTGTGAGTATTTTTGA
ACGCATTCGCCACATAAAATTTATCATCGCACTGATTGATGTCCAATTTT
CGTAAATTCATTGTAACGGCGACGACACCCTTGAATTCGAGCTTATCTTT
GAGTCGATCCCAACCGAAAAATGGTGAAGCGTAAGTGATTACCCACTTTT
TGACTTTGCCTTCGCAATCAAAATACGGCGTTGTCCAATGCCCGTGTTTC
AGGTTGGCCGCACGGTAATGGGTCGGATAGTGTTCATATTTTTTCTTGTG
TTCGCCAGTCTCGTTGAACCGGATATTTATTTTCAAAAAGTATTTTTCCA
ATTCATCAAAATTCGTAGCCCAACGTTGCTTCAAAAATTGGAACCAAGGC
TTGTTCGTGTAAACTTGTTCAGGCTCGTCAAGTCTCGCCAAGTCTTCGAG
TTTGAATTTTCTCGTATTCAACTGAGTCTTGTAGGCGAATGGAGCAAAAT
ATGTTCGATTTGTGAATTTATTGCGTTCCCAGTATGTACCGGCGGACCAA
ATTTTCGTATCGCCGAATAAAAGCGCCAGAGTCTCACCAATTACTTGATC
TTCGGTCAAAGGTCGATCGGCAACTCGTTTGCCCGAATAAACTTCTTGGG
GATCAGATACTTGCAAAAATGCGCTCAAGAAATTGGCTAATCTTGTGGCC
ATTTTAGCTTCATTTTCGAAAAACTCCGGAGCTCCCCAGCCTATGTCACC
GTGAAGGGTCAAATTCTGTTTCGAATATTTGGCACAATTTTTAGGGTTTA
TGCTAAGTATAAATCTGAGTGCTTCGTCGATGTTCATTTTTTCATCTTGC
AAAGATTCCGGACCCTTAGAAAAGTTGCGATATTCGTAGAAGGCTTCCAG
ATATTTCTCGCGTAAATATAGCGGTGCTTTGTTCCATAAAACCGGCGTTT
TGTGAATCCATCCAATTTTCGTGCAATCAAATCCATTGTAATATTGTTCT
TGCGTAGCTCGCTCAACTATTTCGCCGAGATAGGGTCGTCTTACGTACGA
GGGGAGCCTAAATGATGGTCTACATCTGCACTGATAACCACCTCTTCGTA
ACCCCCATCCGTGTAAAGGTTCACACTCGGTCGTTTCTTTTTTACATCTT
GCAGTATCAGCGAATCGATTTGGACCGCTATTTCCTTCCCCTCGCGGGCA
CTGATTAATGTCAATTCTGTCAAGATCCATTTCCATCACTGTCACTGCTG
TGTATGTTGGGTATTCGATATGCCGGAAACCTGTATGCCTTGGATAAATA
TCCGCAATGGGAACAACTGCGGCGATCATCCATCGGTTAGAACGTCTACA
ATCAAAATAGGGTCTCGTCCATTTTACCGGACCAGGGTACTCATCGGCAG
CTGGTGGGCCGTGGAAATTAAAAGTTTCATTAGTGTTATTGGCATAACGA
ATTTCTATTTGATATGTTGTTTTTGTATCATGTCTGCGATCTACATAGTC
AGGCAACCATTTTCGATACCATTCATTGATCCGATACTCATCCTCGGTAT
AGTCCAGGCTAGGACTGTCTCTAGGAAAAGCACCAAGATCTTGAATGTAG
AAGGTATTTCTGGTTGAAATTCTTTCTAAATGAACAGGATCATTGAAGTC
ATCAGCCCTGAAAGTTCTCGGGGCAAATCTCGGCATTGTTTTGTTGAAGA
AGCCGCGATACGAAGGCGTATAAGACATGTTCGGAGAAAAATACGTGGCG
GAAGCATTGATGTGAGGGTTGGCAGACACATCCGCAACGGAGGAGAGAAA
ATAATACATCATGCCAGGATCGTAAGTGTCGTTGATCGCAGGTCTTATGA
AACGCGATTGGAGTATGTAACTCCAAAAAAATGAACGGCTTAGGGCCATG
TTGTGAAGATGAAGCAGCGCGGTTCTGTTTGGAAAAACAGGATTTATGTT
GACATCCTTAATATCGGGCAAATGAGAGACGGTGTCCTCCGGTAAATAAA
GTTCCGACAAATGATGTATTTCGCAATTGTCACCGTTCACTTTGTCCATT
CGTAATCGTATTTCGTCGAAAGCATCTCGAGGCTGCCACTCGTATTGACC
GACAACGCCCAGCCATAAGAACACGCCTACGAGCACCACCGATTGTAACA
AACACGCCATTTTTTCAAAATTTTTTTGATTCTGTCGAATTTCAACTCTT
ACTATACTATTGCGTAGACCACATTATTCTGACAACACCTTTTATTTAGC
GTCTTCAAATTATTCTGTAATACTATCGCAACACTACTGAGAGGAAGCGA
CACGCCCGCACGCAGTTTCGCGTCTGAGAATCGTGTTTCGAAGCGCGTTA
GACTGTATGATTATATACGATATACGACGATGCAACTAACCTCGCC
back to top