BAP2ALocus_1002_Transcript_1/2_Confidence_0.750_Length_2634 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1002_Transcript_1/2_Confidence_0.750_Length_2634
Unique NameBAP2ALocus_1002_Transcript_1/2_Confidence_0.750_Length_2634
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2634
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1002_Transcript_1/2_Confidence_0.750_Length_2634 ID=BAP2ALocus_1002_Transcript_1/2_Confidence_0.750_Length_2634|Name=BAP2ALocus_1002_Transcript_1/2_Confidence_0.750_Length_2634|organism=Venturia canescens|type=mRNA|length=2634bp
TGGACTTGTTGCTGTTGTTGTTGGACTTGTTGCTGCTGTTGTTGAACTTG
TTGTTGAGCAGCCTGTTGTTGCTGCGGTATCATCTGTTGGCCACCGTAAC
CGGCGTAATTTTGATTCATTCCTTGCTGCATACCCGGGTACATCGTTTGT
TGCTGTTGCTGAGGCGGGAACATTCCTTGTGTTGGACTTATACCCGGAGC
ACCGTGAGCCTGTGATCTCAACTGCTGACGTATGAATTGCCTTTGCATTC
CTGGGAAAGCTCCTGGTCCTGCGACTGGTGGAACATTCGGCTGTTGCTGA
TTTCCGATAAATTGATTCGTCGGCACTCTCATACGCAGCATATTCGACAG
AGCTTGCTTCGACTGATTGTTCATGCCAGGACGCTCGTAACGCGGACCAC
CAACTGGCGTTGGTGGCAATTGCTGACCGTAACCGTACTGCTGGGGCGGA
GTGTGTCCCTGCTGATTCGGATACCATTGTTGTTGTGGTTGCGGAGCTTG
ACCAGGGAATAGTCCAGTCTGCTGAGCAACCTGTGCTTGAGGCTGCTGTT
GTTGCGCTTGTTGCTGCGGCGCTTGCTGTTGCATTTGCTGCGGCTGAGGC
TGTTGTTGCGGCCCACCATAGGGGAGCTGTTGCATTGGTGCTGGTGCCTG
TTGCTGCATTGGTTGTGGAACTGGTATCGCTGGAGTCACAGCGTTTTTAT
TCTTTCTGTGCCGTCGAGGTTTCATAGCTTTGCCCTTTCCAGTGGTCGTT
GTTCCTGTGGTTCCTGTTACACTGCTTCCACTAGCGCTACGACTAGGTGA
ATCAACGCTCATTGGTGTATCAGCTTTGCCAGGTTCCGATTCCTTCTTGT
CAGGCTCGAGATCCTCAGGCGGGAGAGGCGGAGGGTCGAGATAATGATTC
GCCGGTCTTATCTGACTGTGAGTATGATAGCGAAGAAGTTTTTGGGCGTT
CTGATACGTCAGCGGCTTGCGTTCGATTTTCACTGCTCGGAACCAGGCCC
AGGATAGAGGAGCCGGATTTTTATGACCTTCCAGTAATTCCCACGCAGAA
ACCCTCTGAGAATCGCAAACTTGTAACCCCTGTTTCTTGTCGATGCTGTC
GAAACCGGCGATCTTATTGCCCTTCGTGTCTGTCAACGATCCCACCGGTT
CGCAAGCGATCACCTCCATCGTAAGTTTCGGCAAAGGCAACAATTGTCTA
ACGAATTGTATGCTCTGTGAATTCCTATCGCCCAATTCCTTCTTCAATTT
CTTCATCAAATTTTGATAGTGCTTTTTATTCTCGTCCTTCTCGGATTGTG
AGTCCGATACGAGAGTGGAATGTATGAGGGTGGCGAGCATGTCGATAACC
GTGGTGAAGAGTTCGGAATTATTATTGAGATCGATGACACCGTAACTCAC
AAGTTGCACGAGCAAAATAGCCCAATCAGTTGTGACGGTTGTGTTTCTCT
GTATCGTATCGAAAACACCACCCACGAGACTGAAACGCAGCTGCAATGCG
TCCTGAACGACTTCTCTGCCTTTGGGATCTTCCGAACCGGCATTCTTTTC
CTCTTTGCTGGTAGTGAGAAATTGCGAAAGTTGAGAGTGCAACGACGTCA
AGAGACCTTCGCGTTGATCATCCTGACCTTTCAGGCAAGTCAATACCAGC
GAGAGAAAAGGCTGATGATTAAATAACGAAGGAGATTTTAATCGCCCCCT
CTCGCGCCCAGCCGTTTTCGACCAATTTCCCGATTCGAGAACCTGTCCAG
CAACTTTTAACACTCTACCTTGTACGGCCGAGGGTAATTTCGAAACTAAC
GGCGCCACGAGCCAAATGGAACCCGAGCGTTTGTCAATTTTACCCGAAAG
AGTATTCAACTGGAAGACATCGATCGCCGCTTTGGCAACAGTGTCTAGCC
ACTGGGAAAGATCGTTCGAAGACGGTGGAAATTGTTTGTACATTAATTGG
AGATCAAGCCAAGACATGCGAAGGCTCCACTGCTCCAGATTTTCGAGGAT
GCTCGTTATGTGTGTCCGCTGATCGTGAAAAGCGTCTAAGGATGTTTCCG
GGTAACATATCATGTGCAAGAGACGCTGGGCTTGACGAGGCGTTAACATG
TTGTCAAGAAGCATATCTGGATGACATAGCTCTTCAGGATTTTGCAAACA
CCTCTCCAGCACCCATTCTTGACTGCATATCTGCCGTAATACGTGTTGAG
CAAAATCCGAAAGTCCTTTGACATTCTCAGTGGCAATACCGGCGCTGCTG
CTCGACGAGGACATGGCCAATTCGAGTCCCAAATCATCACCACCTCCGAG
AATATCACTCGTGCCAAGAATGTGACTTATCGACAATTCCCCGGGTCCCG
AGCCAGAACCACCGACGCTCGCCGGTCCGCTGGCTTGGCCCGAGTGCACC
ATCGGTACATCCGGCTTCTTTGGTGGCTGCTTACCCGCGGTCGCATCTCC
AACTACGAGTATTGCTTTGAGAACCGCGAGAACTGGTCCAACGCGAATAT
TGTTATGAGCCGCCGCCAGCAAATGACGATCGCAGCTTAGCTTTATGCTG
TAACCACGTGGATTTCCACTTGGCAAAGGATGCGGACTGGTACTAACGGA
GTACAAAGATGGCTGTGGACATTCGACCGTTTTG
back to top