BAP2ALocus_1005_Transcript_2/2_Confidence_0.750_Length_647 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1005_Transcript_2/2_Confidence_0.750_Length_647
Unique NameBAP2ALocus_1005_Transcript_2/2_Confidence_0.750_Length_647
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length647
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1005_Transcript_2/2_Confidence_0.750_Length_647 ID=BAP2ALocus_1005_Transcript_2/2_Confidence_0.750_Length_647|Name=BAP2ALocus_1005_Transcript_2/2_Confidence_0.750_Length_647|organism=Venturia canescens|type=mRNA|length=647bp
GAACGTATGATTCCATCATTGGGTTTCTGTATAGCCACAATTCATTCTCG
CGAGTTTTTGGTTCGATGTTCTCTTTCGTATTGTTCTGGCAGTATTATTT
GTGAAGCTGGAAACTGCTGAGCCATTTAACAGAAAAATTCACGAGAATGA
ATTGTGGCTATACAGAAACCCAATGATGGAATCATACGTTCCAACAACCA
TTTTATGGGAAGACCAAGACCAGATTTCTATTGGCGATGTTTTCCTGATG
GCCGAGGAAACACAGCATTTGATTGCACCGGCGATCCCAACATCATAAGA
GACGGAAGGAAATCGTTTCCCAGTGGACATTCTTCTTTTGCCTTTGCGAG
TTTTGGTTTTGTCGCACTGTACTCAGCTGGAAAATTACACACATTTGGCA
TAGCGGGTAAAACGCAAACATGGAAACTGTTTATATTTATATGCACAATG
AGCACAGCACTTGCGATTGCTCTGAGTCGAACGTGTGATTACCATCATCA
TTGGCAAGACGTGGCCGTTGGATCAGCAATTGGAATATCAATAACTTATC
TCTGCTACAGGCATTATTATCCACCACTGGATTCTCAATTTTGTCACAAG
CCGTACACCACCGTTTTACGGCAAATTCAATCGGACAGAGAAAAAAA
back to top