BAP2ALocus_1007_Transcript_3/3_Confidence_0.714_Length_3220 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1007_Transcript_3/3_Confidence_0.714_Length_3220
Unique NameBAP2ALocus_1007_Transcript_3/3_Confidence_0.714_Length_3220
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length3220
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1007_Transcript_3/3_Confidence_0.714_Length_3220 ID=BAP2ALocus_1007_Transcript_3/3_Confidence_0.714_Length_3220|Name=BAP2ALocus_1007_Transcript_3/3_Confidence_0.714_Length_3220|organism=Venturia canescens|type=mRNA|length=3220bp
CGCTTGCCAACATGGAACGGTACTTGAGGTTTAAACACACCGGTCAAAAG
AGAATTATTATATATTGAGGCGTGTAATTATTACATGATGAGAGTCTTAG
AATTGTACAGTGGCATCGGAGGAATGCATTATGCGCTTAAAGAAAGTGGG
ATACCTGGACTAGTAATTGCAGCCGCTGACATAAATACAGTAGCGAATGA
GGTGTATGCCCACAATTTTCCAAGTGTCAATAATATAAACAGAAATATTG
AATCATTGACAGCAAATGAGATTCGGAGCATGAAAATTGACACGATATTG
ATGAGTCCACCCTGCCAGCCTTTCACACGAGTTGGCTTACAGAAAGATTC
AACGGACAACAGATCTTCATCGCTTTTGCACGTGCTTACATTGATTCCTG
AAATTGACATTCTAAAGCAAATACTGGTAGAAAACGTCAAAGGTTTTGAA
AGTTCAGAATCAAGGAACGCATTGGTGGATTGCCTGGAAAAATGCGGCTT
CAATTACAAGGAATTGATTTTGAGTCCTTGTCAGTTTGGAATTCCAAATA
GCAGACACAGATACTACTTGTTGGCTAAGCGAAAAATGTACAAATTCTGT
TTTATCAACTGTGGCTTGGAGTATTCGCTGTCCAACGAATTGAAGAAAGT
ATTGCCAGAAGATCGTCATCTGAGGTTGGTCATCGAGGACAACCAGGCGG
ATCGAGAGCCCTCCAAAAATTGTTACCCCCTTGATCGAATAATTGATGAA
AATATTGACGCGGAAGATTATTCCCTTCCAGAAAAATTGCTCATGAAACG
AGCCTCTGTGCTGGACATTAGAACCGCTGATTCGCGAGGCTCGTGCTGTT
TCACGAAAGCTTACGGACGTTACGTCGAAGGCACTGGCTCTGTTTTCAGT
CCATTTCCTCAAATTGTTGTCGATGAAAAATTTCGTGAGTTCAGAAACCG
TCTCCGTGAAAACAGCGAAGACTTTACAAGACCTTTGACCGACTTGAAAT
TACGGTTTTTTACGCCGTCAGAAATATCGAAGTTAATGTGCTTTCCCCAA
TTTTTCACTTTTCCAAATTCCACAACTAGAAAACAGAAATATAGACTTTT
GGGAAATTCCATAAATGTTCACGTCGTAAGCCGTTTGATTTACTTACTCA
ATCAGGAATAAGTGCTTGTGATATTCGTCCTTGTCGCTGTTTGTTTTTTT
TGTTTTTTTTTTTTTTTTCAATAAACATTATATTGTTGATCTTTCAGATA
TATATGCTATTATTTTGATTTCGAGTAACCAATTAAAGAATGACAACTCT
GAATGATTCAGTCGATACTTTTAATTGCATCGTCAATGGAATTTTTTAAC
TCAACATGTGACAACCAGCATTGCTGGTTGTCGTTAAATTTCCAAAAATG
AATTTTCATGCTTTTAATTTATTTTTTTTTTTTTAATTCCTACTCGCTCG
CTAGCAGCGCACGTCAATCAAAATCTTGTGATGTTTTTCAATGAGTTCAA
AAGAATCAGATTCATTTAAACTTACGTATATTGGCGTGTATAGTATATCC
ATAAATATACGCCTCTACTATTAAATATTGCTAATCATTTTCGCATTGAA
ACCCTTTTATGAAATTGAATCTCTTATTTGAATTCCTTTTTCATTTACCT
ACCTCATACAGACGCGGGATAATGGGAAAGGGTGCCGGCAAGCCCGGTCG
TTGTTTATTCTACTTCAGTCAAATTTGTGTTTGCTTTATCTTTGCCTGCT
ATTATTCTTTTTCTATATATAAATCACGTCGAGCCATCCAAATGTACTCG
AAACCCTTGTCAATCGTCATTAAGAACAACTATTCAAGTATTTATTTAAC
ATATAGTCGTTGAAAATTCGAACTATAATATTTTCCCGTATGCCCAGGAA
TAAATCATCAGATGATTTTTTATTCTTTGCTCCTAAATTTCGATAATAGA
GAAGTTTTCTATTCGTAGAGAGAAAACTAAACGGTTCTATTTGCATGCTA
TTACTGAATTTATATATCTGCGCTATGTTGAGAGACACGGAATAAAATAA
CTGTTTTGAAAATTTGTTTGTCAAAAGAAAGTCGAACGCAATGCCGAAAG
AGTTTTGATGAATAATTCGCAATAAGATGCCATTCCTCAACCATCGGATG
ATCTATGTCAGCATTTTATATGAAAGTTATTAAAGAATAATGATTATTTA
AGGAGATTAATATTTGAGAATAGAATTTGTAATTAAGGTGGCTTGGGCTA
TGCCGAGAAAACTTAAAAGACATCAGGAAGAATATCCTGTTAGCTGGACG
CTGTGCCAGGAGACATGGTATTCGAAACGGCGTTGGCTTTTCCAGGGAAG
TGTGATAGTTGGATTTTATGCCACAGAGACTATAATAGGGAAACATGTAG
AGAGATTATAAAAGAAAGATTGGAATAAAATGATAAATAACCGGCCCCAG
CAGGGAAACATCACTTTAATATATAAAATGCCTTTTTTACAATCGATTCG
GGCTTGCCGGCACCATTTCCCATCATCCCACTGACTCCAGCTTTTTCATG
GTGTCTTTTTTAATGATTTGGAATCGAACCAAGGGGGAATTTGAAAAAAA
AATTCAACCTCAAATAAGGATCACCCTCATATAGCATTCTACTACAAAGG
ATAAACTAATAAAAATAATTCGAGATATTTGGGTAAAATAATTCAACAAA
TCAATAACACCGTCAAACAAAAAGGAAGTGGTACCTTCATCAGACCCATA
TCTTACATCTATGTATTTTGTTAAAACTGTTAAATTTGGTTAAAATAGTG
AAAAGTCGGAGTTAAAAAGAAACATTTTATCGATCTAGTTGATCAACTCT
ATGTATTTTTACTCATTGGATCCTAACTCGGAATCTGGTAATCTTGACGT
TATGCCCATAACGTTATCCATATATTGGCAAAAATCGTAAAATAAATAGA
ATGTCTTATGCTACACAGAGAGAAAAAGAGTAGTAAGAATTAATATGCTG
CTATAGTGTTATGGTTTTTATCGCCCATTTTGGAGGTTTGCACCAAAAAC
GTAATTTTTATGTCGTTTCCAAATAAAAATTTCTGAATTGTTTATTTTAC
AGTTGAGCATCGTGTAATTCTATGAGCTCGAAAACAAGTATCGCCGATCC
ACTGAAATATTTGAAAATTTATTACGGTACCAGTTTCGATTTTCCGAAAA
GTAACCAAATTGCATAATTA
back to top