BAP2ALocus_1008_Transcript_1/5_Confidence_0.545_Length_3210 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1008_Transcript_1/5_Confidence_0.545_Length_3210
Unique NameBAP2ALocus_1008_Transcript_1/5_Confidence_0.545_Length_3210
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length3210
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1008_Transcript_1/5_Confidence_0.545_Length_3210 ID=BAP2ALocus_1008_Transcript_1/5_Confidence_0.545_Length_3210|Name=BAP2ALocus_1008_Transcript_1/5_Confidence_0.545_Length_3210|organism=Venturia canescens|type=mRNA|length=3210bp
CTTTTCTCTCGTTCGTGCTTGGTGAAAAGTGTTTCCAATCGTTCTCCTAC
GATGATTACTTCGAGGAGACTCGCATGTGCGTCTTTCCTGTTAATTACGT
TATTGGCTATCAATTTTGCTTCGATTGAGGCGAGACGATTCAGCAGCGGT
GGACGATCGAGGTCGTCAGGCTCCGGAAGAAATACCGGTCGAGTCTCCTC
TCCAAGGCAACCTGTTTACATACCGAAAACGCCGGTTTACGTGCCCAAAC
CTCCAGCTCACGTGCCGCCGAGACAACCAACGTCGTCCGGAACGAGTTTT
CCACAGCCTCATACACCCCACAATCCAGGTGATTCGTTAAAACCGATTTT
CAATAGTTTGCAACACGAAAATTAGGAGATCTCTTGATTTTTTATAGGAA
TTAGCAAAATTACTATTTTTGGGAATTTCAGGTTCAACCAGTGGAAAAGA
CAGCAGTCACATACTCATTAATGCGGAAGGCGGTGGTCGACCTCGGCCAG
GCTCAGGATCGAATGATAAGAAACCACAGTCTGCGCCTCATCAACCTTCG
GCACCGTACGACTCCCCGGTACAGAAAGTAAATGCAGGACACGTACAGAG
CGGAGCTCCAACTAATGGTTCACCGAATCCAAGCGGCAGTTACCCGCCGT
GGGCGAATCCATCGGCGAATCCTCAAGGTTCGATTCCAAGTGCCCCGCAC
ATTCCGAGCCAGCCTCACGGAACGGGATTCCCGAGTTCGCCGTACAATCC
ATCATACCCGAGTCAAGGGAAGCCGGGATCAGGACCACTGACGTCAGCCC
CTTATCCGCCAACGCATCCCGCCGGTCCCATAGCGCATCCCAACGTCGTC
TCAGCGCCCCATCCGAATACGTATCCACATCCAAATGCGCCATATCCTAG
TGCACACCCCCAAGGAATGCCGATGCCATCCGCGCCCCACATCGGTTTCG
GGAACAACGCTCCTCATCAGCCAATCGGAGCTCCGCAGCATTATCCTTCC
GTTGGTTCTTCCCCGATGCAGCCTCATGGTGGATACTCGCCGCCACCTAC
CATCGTCCACAATCATTACAACGCTCCACCGATCGGCACTCCACAAAATC
CAGCAGGACAGCCCATGTACGGGCACCAACCGGCCTACGGCGGTGGCCCT
GTCCCGATGGGACAGCCTTACGTTCCCGGACAAACTGTCGTCGTTCTTCC
AAACCAACAAAGCCAGGACAGCGGTCGTGGCCTCGGTCAACTCTTCAAAG
AGGCTCTCGTTTACTCCACCGTCAACGCCGGCGTCAACAGGATCATTAAC
GGCGCTCCCCATCATCATCACGACGGTTATTCCTCTTCACAACCGGCCGC
CCAACCTGCCGCAGCCTCTACGACCTCCACGGTCACCAACACCGTTATTT
ACAATCAATATGGCACCCCGAACCCCGGTGCGAACGGAATACCCGCTCAA
GGCCAGCCCGCGGCCTCCGCTACACCCGGAAACTCCGCTGGAACTTCCCT
TCCCAGTTTCCCAAGTGGAAACCCCAATTCTGGCTCACCGACCGGCTCCC
CCAGCTCCAATCCCTCAACAGTCACCGATGGACACCCCAATCCTAGTTTT
CCTCATCCTGGCGCTAACCCCACTTCGGGTACGCAGAATCCCGGCCAAAC
TGGCACTCCGAGCAACCCACTAAATTCCAACAATCCTGCTCCCCAGTCCG
GAACCCCTTCGGTCGCTCGTACGAATAACACGAACAATGAGACCGCTCCC
CCAGCTCCGGAATTCGTTTATTTCATTTCTAACGAGGAATTGTGGAATCT
TACCGAAAGTCTCTTCGCCAAAGATGAGATCAAAGCCAACCAATATGTTC
GGATGAATCTACAAAAACGATCGGTCAATCCGAATGTCACTGACGAAGCT
CCTCAACGGCTCCTCAACGTACGTGACGAAGCTTACGCTCTGCCAACGAT
CCAAGCGGTTCGTGAAATGTACGACAACTACGAATACGATTCAGAAACAA
AGGAAATTTCAAATTCGGACAAGCGCCGTCAGGAAAACGTGTTTCTCGAT
ACTCTATTAAACACAAACATAATGACAACAGCGATGAAATGGTTGTCGAA
CAAGGGCTACGTCGAGTCCGATGATTTCGAGTGGAAAGATACCCTCCGCC
ATATTTGGCTGAGCAAAGTGAACGGCGCGACTTGCGGTTTCGAGAGAATT
TTCTTAGCCGAAAAATATCCTGGGCCGAGTGTGATTGGTGCTCAAAATTG
GATCTACTTTGATTCTCGAGAATGGCTGCGAAAAATCAATTACATGAGCT
ACGTCGACAAAGTCGATTTGGGCGACAAAGCAACGCTTGTGAAGATAAAC
TTCAAAATCGACGACGTTCCGAAAGCAAACACAACGATGTTGGTCGGCAC
TCCACCCGAATTGGAAATGGCCCTGTACACTGTTTGCTACTACGCAAGGC
CGAACGATTTCTGCTCGGTGTCGCTCAACGGAACGAAGTTCAACATTTAC
ACGCACTCTTTTCGTTACTTTGGCAAAGACGTGATGGATCTCGGCCTCAT
GTTCTTTTAGTCTCATAAAACCAAAACTTCAGCACTGAAAAATAAGGCGA
AAGTAGGAAATGATTAACAAGTTTTTTCATTGTTATGAAATTTCAATAAT
TATCTCACGAAAATTCTACACATTGTAGATATACGCGTCAACTTAGCTGT
CATGAAAACAAATGAAACAAAAGAGTAGAGATTTGCGCGATAACGAATGA
AACCGGAAGTCCGCACGAATCGAGGCATCACTCGTGGATTCATTGTCGCT
CGATCGTTGCGCAATTCGCGTTCAAATCACGCCCCTCATTTCGACTTCAT
TTTCTTCACCGCTCTTTGCAATTCGTAGTTGTCCCTTCTACCTCTGCTCA
TCGGTGCAACGTACCCTCGAGGTTTAACCAAAGATCCAAAGTTGAGTTTG
ACCTTGGAAAAAAATGAGGAAAGAACGTTATTCATTTTTTGACCGTTTTA
TGCTTCTGGGCGGAAATAAATCGTGTTTCTCTTTCCCAGAAACGTGCCGG
AAAATCATAAAATACGATTGTTCACGTAAACGTGGAACGATGGAATGATT
TTGTACGAAATTTATCGATATTATTTTGTAAGAAACGTTGATACGCTGAT
GATTTAAATAAAGAGAAAAAAGTAAATTGAGCGCAAAACGATGTTTCTCG
AATAACAAGA
back to top