BAP2ALocus_1008_Transcript_3/5_Confidence_0.455_Length_3454 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1008_Transcript_3/5_Confidence_0.455_Length_3454
Unique NameBAP2ALocus_1008_Transcript_3/5_Confidence_0.455_Length_3454
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length3454
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1008_Transcript_3/5_Confidence_0.455_Length_3454 ID=BAP2ALocus_1008_Transcript_3/5_Confidence_0.455_Length_3454|Name=BAP2ALocus_1008_Transcript_3/5_Confidence_0.455_Length_3454|organism=Venturia canescens|type=mRNA|length=3454bp
CTTTTCTCTCGTTCGTGCTTGGTGAAAAGTGTTTCCAATCGTTCTCCTAC
GATGATTACTTCGAGGAGACTCGCATGTGCGTCTTTCCTGTTAATTACGT
TATTGGCTATCAATTTTGCTTCGATTGAGGCGAGACGATTCAGCAGCGGT
GGACGATCGAGGTCGTCAGGCTCCGGAAGAAATACCGGTCGAGTCTCCTC
TCCAAGGCAACCTGTTTACATACCGAAAACGCCGGTTTACGTGCCCAAAC
CTCCAGCTCACGTGCCGCCGAGACAACCAACGTCGTCCGGAACGAGTTTT
CCACAGCCTCATACACCCCACAATCCAGGTTCAACCAGTGGAAAAGACAG
CAGTCACATACTCATTAATGCGGAAGGCGGTGGTCGACCTCGGCCAGGCT
CAGGATCGAATGATAAGAAACCACAGTCTGCGCCTCATCAACCTTCGGCA
CCGTACGACTCCCCGGTACAGAAAGTAAATGCAGGACACGTACAGAGCGG
AGCTCCAACTAATGGTTCACCGAATCCAAGCGGCAGTTACCCGCCGTGGG
CGAATCCATCGGCGAATCCTCAAGGTTCGATTCCAAGTGCCCCGCACATT
CCGAGCCAGCCTCACGGAACGGGATTCCCGAGTTCGCCGTACAATCCATC
ATACCCGAGTCAAGGGAAGCCGGGATCAGGACCACTGACGTCAGCCCCTT
ATCCGCCAACGCATCCCGCCGGTCCCATAGCGCATCCCAACGTCGTCTCA
GCGCCCCATCCGAATACGTATCCACATCCAAATGCGCCATATCCTAGTGC
ACACCCCCAAGGAATGCCGATGCCATCCGCGCCCCACATCGGTTTCGGGA
ACAACGCTCCTCATCAGCCAATCGGAGCTCCGCAGCATTATCCTTCCGTT
GGTTCTTCCCCGATGCAGCCTCATGGTGGATACTCGCCGCCACCTACCAT
CGTCCACAATCATTACAACGCTCCACCGATCGGCACTCCACAAAATCCAG
CAGGACAGCCCATGTACGGGCACCAACCGGCCTACGGCGGTGGCCCTGTC
CCGATGGGACAGCCTTACGTTCCCGGACAAACTGTCGTCGTTCTTCCAAA
CCAACAAAGCCAGGACAGCGGTCGTGGCCTCGGTCAACTCTTCAAAGAGG
CTCTCGTTTACTCCACCGTCAACGCCGGCGTCAACAGGATCATTAACGGC
GCTCCCCATCATCATCACGACGGTTATTCCTCTTCACAACCGGCCGCCCA
ACCTGCCGCAGCCTCTACGACCTCCACGGTCACCAACACCGTTATTTACA
ATCAATATGGCACCCCGAACCCCGGTGCGAACGGAATACCCGCTCAAGGC
CAGCCCGCGGCCTCCGCTACACCCGGAAACTCCGCTGGAACTTCCCTTCC
CAGTTTCCCAAGTGGAAACCCCAATTCTGGCTCACCGACCGGCTCCCCCA
GCTCCAATCCCTCAACAGTCACCGATGGACACCCCAATCCTAGTTTTCCT
CATCCTGGCGCTAACCCCACTTCGGGTACGCAGAATCCCGGCCAAACTGG
CACTCCGAGCAACCCACTAAATTCCAACAATCCTGCTCCCCAGTCCGGAA
CCCCTTCGGTCGCTCGTACGAATAACACGAACAATGAGACCGCTCCCCCA
GCTCCGGAATTCGTTTATTTCATTTCTAACGAGGAATTGTGGAATCTTAC
CGAAAGTCTCTTCGCCAAAGATGAGATCAAAGCCAACCAATATGTTCGGA
TGAATCTACAAAAACGATCGGTCAATCCGAATGTCACTGACGAAGCTCCT
CAACGGCTCCTCAACGTACGTGACGAAGCTTACGCTCTGCCAACGATCCA
AGCGGTTCGTGAAATGTACGACAACTACGAATACGATTCAGAAACAAAGG
AAATTTCAAATTCGGACAAGCGCCGTCAGGAAAACGTGTTTCTCGATACT
CTATTAAACACAAACATAATGACAACAGCGATGAAATGGTTGTCGAACAA
GGGCTACGTCGAGTCCGATGATTTCGAGTGGAAAGATACCCTCCGCCATA
TTTGGCTGAGCAAAGTGAACGGCGCGACTTGCGGTTTCGAGAGAATTTTC
TTAGCCGAAAAATATCCTGGGCCGAGTGTGATTGGTGCTCAAAATTGGAT
CTACTTTGATTCTCGAGAATGGCTGCGAAAAATCAATTACATGAGCTACG
TCGACAAAGTCGATTTGGGCGACAAAGCAACGCTTGTGAAGATAAACTTC
AAAATCGACGACGTTCCGAAAGCAAACACAACGATGTTGGTCGGCACTCC
ACCCGAATTGGAAATGGCCCTGTACACTGTTTGCTACTACGCAAGGCCGA
ACGATTTCTGCTCGGTGTCGCTCAACGGAACGAAGTTCAACATTTACACG
CACTCTTTTCGTTACTTTGGCAAAGACGTGATGGATCTCGGCCTCATGTT
CTTTTAGTCTCATAAAACCAAAACTTCAGCACTGAAAAATAAGGCGAAAG
TAGGAAATGATTAACAAGTTTTTTCATTGTTATGAAATTTCAATAATTAT
CTCACGAAAATTCTACACATTGTAGATATACGCGTCAACTTAGCTGTCAT
GAAAACAAATGAAACAAAAGAGTAGAGATTTGCGCGATAACGAATGAAAC
CGGAAGTCCGCACGAATCGAGGCATCACTCGTGGATTCATTGTCGCTCGA
TCGTTGCGCAATTCGCGTTCAAATCACGCCCCTCATTTCGACTTCATTTT
CTTCACCGCTCTTTGCAATTCGTAGTTGTCCCTTCTACCTCTGCTCATCG
GTGCAACGTACCCTCGAGGTTTAACCAAAGATCCAAAGTTGAGTTTGACG
GAAACCCGCATGAATTAGTGATAAAATCAGTACTTGCGTTTATTTACAAA
TTACACGGGAACGTCAATGCGATCAGACTAGCGCTTTTTCTGCTGTTTTT
GTATTTCATGATTCATCGTTCCTTTCGATCGGCTATTTTGTAACGACAGT
CGATCGTCGATCGTCATTCGAAAACCGGGGAGACAAACGATTTCGAGATA
TTCCAGAACGCGAGTTGTTGGTCGTTGAGGCTAATTTCTTTTCGGCAAAT
CTCGTAAATCAATTCGTCCCAGTTATTCTATGAAAATTCGAAAAAACGTG
TGCGAGCTGCAAGTTGGAAGTTGAAGTTCGAAAATTGTAGTGAAGCTACC
GATCCAACTGGTTTGGGAGTTCGTCGTAAAAAAATTTTTATTACGATTCG
CTAGAAGAAAAAACAACAGGATGCAGTGGAAAACTCGAGAACGCGTTCCA
GTCGCCCCCGCCAAGAAAAAAATCTGGCAAAATATTAAAAGCGGCATTGA
GGAAAGAATTGTGTTCGAACACGCTAAAGTTGCTTACGCTAATAAAATTT
ATAAAACAGTCAATTGCTGAAAGAACGAAATTGTAGCAAAAAATAATAGT
CAGT
back to top