BAP2ALocus_1008_Transcript_4/5_Confidence_0.273_Length_297 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1008_Transcript_4/5_Confidence_0.273_Length_297
Unique NameBAP2ALocus_1008_Transcript_4/5_Confidence_0.273_Length_297
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length297
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1008_Transcript_4/5_Confidence_0.273_Length_297 ID=BAP2ALocus_1008_Transcript_4/5_Confidence_0.273_Length_297|Name=BAP2ALocus_1008_Transcript_4/5_Confidence_0.273_Length_297|organism=Venturia canescens|type=mRNA|length=297bp
CCAGTGTCAGATTCTTTGATACCCGTCAATTCGTTTACCAGCTTTATTAT
CGTTTGTATATCTTCCTCTATCGTTTTGATCGTTTTATGCTTCTGGGCGG
AAATAAATCGTGTTTCTCTTTCCCAGAAACGTGCCGGAAAATCATAAAAT
ACGATTGTTCACGTAAACGTGGAACGATGGAATGATTTTGTACGAAATTT
ATCGATATTATTTTGTAAGAAACGTTGATACGCTGATGATTTAAATAAAG
AGAAAAAAGTAAATTGAGCGCAAAACGATGTTTCTCGAATAACAAGA
back to top