BAP2ALocus_1009_Transcript_1/4_Confidence_0.600_Length_4010 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1009_Transcript_1/4_Confidence_0.600_Length_4010
Unique NameBAP2ALocus_1009_Transcript_1/4_Confidence_0.600_Length_4010
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length4010
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1009_Transcript_1/4_Confidence_0.600_Length_4010 ID=BAP2ALocus_1009_Transcript_1/4_Confidence_0.600_Length_4010|Name=BAP2ALocus_1009_Transcript_1/4_Confidence_0.600_Length_4010|organism=Venturia canescens|type=mRNA|length=4010bp
AAGAAAAAAAAACGCCATGTTTGCTACCTTAAATAAAGCGCATGGGGCGC
GAATCGACGACGCTGGATTGTTCGGGTTAAACGGGGCTCTCATTAATGTT
CAATCTACGTTTTGAAATTGAAGCGTTTTGTTTGTTTATTAAATTTAAAC
GATTCTCTCGACAATCGTGTTTTCTTTTAGAATTTATAAGAAAATTAAAT
TTGTTGACGTTTAAAGTAAATAACCTAGGGCACTCCGGGACCCTACTATG
AGAAAAATGCACGCACGGTCATCGAGACCGATTGTCGACAAAGGGCGCAC
GTAACCATACCTGGCGCACACTTGACACAAGATACCATGTGGCCGCAGGG
CAAAAATACGACCCCCAATTCCTCGCCGTAACATATTTTACAGAGACGCG
CATCGTCGATTGGCTTCTTCGCGTTCTCCTGCGACGTCGTACCAGCTTCG
ACCTTTTGCGGACTCGATTTTTCATCCACTGTTGCACTTCTCGATCCTTC
AACCAGGCTGTTGACGCTGGTGCTGCTGCTCTGAGCGCTCGGACCCGCGT
TGCTCGATTTTTCACCATCTTTCTCCTTTTCCGAGCTCACTTTTGGCTCG
ACCTTCTTTATATAACTCGGCAAATTCATTTGCATTGTTTCCTCGTTGGA
AGGCAGCGAAATGGTCTGACCGGTGACGGTGTTGACGTATGCCTGTCCTT
TCACCATAAGGAGATAATAACATTTGGAAAACCATTGTGCATGTTGTTCC
CACGGATCATCGGTAGGCTCCCAGTCTTTAAGACCTCCCCCGCAGTGATA
ACAAATAGTTTGATCACTTCTGCCGGTGTACCAGAAGCCAGCATCGGCGA
GGCACTCTTTAGTTTGTGGCATAGATTTTGGCCATGATTTGAAAGTACTT
AGTCTGGCGTCGTAACTGGCATACTCCGGATGAGCCGGTCCTTTGGGTCG
ACCGATTCCTAGAGAGCCCAATTTAGCTGTGCTTGGCAGGGGAATATCGG
ACGATGCGGTGTGACAATCCGGCACAGAACCCGGTCTATATTCGATTCCA
TAAGGGCCGCAGACGTCGTGACCTCGTGGTCTTGGCTGTGGTATAGAATT
TGGATTTTCACCAATGGGCACGTTTCCGCATGGAATTTTTCTTATGAAAC
GACATTGTTCTTGCCATCTTTGATGCTCCGTCATTGGATTGTCACCTTCT
ACCCATCCACCGATATCCACTTTGCACTCAAAACATTTAGCTTTGTCACC
CTCGCCGGTATAGTAAAAACCAGCTGCTGCCATTTTAGCTGGATCCAAAA
ACGGCACCGGCCATGTTGAATAACTTCTCAGTCTGACCTCCTCCATACGA
TAATCACGGTTATCCACTTCGTCTACCGTTGCTACCAGCTGAGAACGTGG
TGAAAACAACGGAGAACGATTCGTCGGCACTATCGACTGCTTCATGGAAC
TAATATTATCTCGCAGGTCGCAGTGCTCTATGATATCCGTCATTTTATCG
TTTTTCACGGTACTCTCTCTCAACCTCTTGTTCTCTTCATGTATATGATG
CTCTTCGCCTCCTTCCCTTGAAGGACATCTATCGATAATCATGGTTCACT
GTGTGATGATTTATTTCTCGTACACGTGATTTCAAAAATAAGAAATGGAA
AAAAACACTGGTATACACGGACGCGAATGTGCGCTGCGGAATGTTTTGAT
ACTTTTGATACGCTTTGCGTCGTCAACAACAAAGTCGTAGAAGAAGCGAC
ATCTGGCGCGAAAAACTCTTGGATATAGCCGCGTCACGAAAACACGCCTC
ATTAGCCTATGAAATTAGGAAGTTCCCAATTGTTTCGCAACTGTCAAGAG
AACAACACGTGTTGAGAAAAAACTACAGTCGCAATTCAGATACCACGAGA
GTATAAATTTGGTTATACAGAGAAGCACAAAAAACTCACTTTTCGTTTAT
TATGAAAATAATTGAGAGAACGTACAGAGTCGGAAATGAAATTTTAAAAA
CTATTGAACAGTGTAATGTTTTTCAAATTCCATGTTTTTGTTCGAATACA
CAATTCGCGCACTGAACTTATTTTAATCGATTACGCGTGTGCCCGGACGG
AAATACCGAAATGAAGTCTCATCGACGGATAGTTTTTCTACTACGCGGAC
GGCGCTCTGACGGGAAAAGAGAGCGATGGAAGAAAAACGAGACAGAGAAT
GGGAGTGAAAGAGATAAAAGATATCCCGTAGTTCCCAGAACGGCAGGGCA
CTCGAGAAACTCTGAGAAGCGACCTCGTGGTCACAATCGTGGCTCGTATT
CACAGTCCTGCCCCACAGCTGTACACAGCTCGTTCACCCGCCTATAAAAA
ATCAACGTGCGTTTGCTATCGTTGAGTAGCACAAGACAATGGGAGTGGTG
CACTCGATCAGAAATATCCGAGCTAGCAAAAGGGACATAAATATTGAGAG
TCTACTGTACAATGACAACACAGCTCTCCGGCAGCCACATCGCGGTCGGA
GTCCACGTTGAGCGCTCCCTTCCCTAGGGGATTTTAGTACACAGTCCGTA
CGAGTCGCACGAGCGGTACGATGAATTCTCATTCCCCCCACTCGGAGAGA
CCATAGGAATGCGCGCGGGTCTCCGGGTAATTATTGTCTGGATATATTCC
GAGCCAACATTGCGAATACTCCGGTGAGAATTTGAAATTCACATTGAACG
AGAAAAATAAAGTAAAAAAATCGTAAAATTTGCTTTGGTTCAACGGCCCG
AAATAGCAAGCAAATATAAGTAAGCGACGGAGTAGTAAGAGAAGTAGATG
AATGAAGGCATCAAAGCTTAATATTAAGGCTTTCGGTCCCCTTCGTTAGG
CGAATCATGATTATTCGCAATAAACATGATAAGCGCGTTGGACAGCTAGA
GAAAACGGCGAGTCGCGATTTCTGCGTCGAATTTCCAAAAAAGGCCACGA
AGCGCTGATTCACGCGTTCGTGTTGTGATCGCCTTCCCACGAGTATTCCC
ATATACAATAAAAAAAATCCTTCCAAGTGTATATAAATATAAAAAAAGAG
CACGCGGAGTGGCTTAAAATAAAGAAGACGTAATAGTTCGAACAGTTCGT
TTTCTAGGCTCGATGTACAGCCTTATAACGAAGCATTGAATAAGCGCCTC
AACACATATACATATCGACATCCCGATTCTAAAGACCACACAGTTTCTAG
GCGCTCGTGTAAAGGAGCGATCGATACACAGGCTGGGCTTTCATGAATGA
CGTAGCTTTAATCTGTGCCATTTGCGACGCAAGAGGAAAAAATAAAAAGC
AATCCTACCCGTTTTTGGGAGCGTCTGTTCTCCGCGTCAATTCTTCACGT
GGGAGTCAATGTATTCTATAATACGCGTATATATACGTGAGTTGATGGGA
TTCGAGAACATGCTCGTGGCTCTTGAAGTTTTAAACATTCGTGTGCGCGT
ATAGATATATATCGCGAAACAGTAATCTTTATTTGAACTTTCACATGTTT
TTTTTGTCTCTCTTTCGCATTCCCTCCCCTCTCTCTCCTTTCCTCCCTCC
CGCGGTCCTCACAAACGAGCCGGCAACGTCGCACAACGGAAGTGGGCACG
TAAGCAAGATACAGATATGTATCGCGTTGTGTGTCCCGCAGTACAAAGCC
CGTTGGCTGTTCTTTGTGCTATAATGCCAGACGGCAGCAAGGAGAAGCGA
GCAGGACTCTCTTTTCGGTTTTCAACAGGAAGCCACTTTCGAAAAGATAA
ACTATACGTATGGAGATATATTATCGTGCATGGATATATATGTGAGCTCG
ATGTTGAGGAAGAATGAAAAAAATAAGGAAAAATAAAGAATAAACAGATC
CGTTTTGAAGGTTATGTAACTGCTGAAATTTTTCGACTGGGTTGTTTGCG
CGTGATATCGCATAGTCGCCCGAGGAGCGTCTTTGTATTCGATTGTAATG
CTTTTTTTCCAGTTGTCTTATCTAACGAGGTTTTCAACATCTCGAAAAGT
AGAGGATATA
back to top