BAP2ALocus_1009_Transcript_2/4_Confidence_0.400_Length_1788 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1009_Transcript_2/4_Confidence_0.400_Length_1788
Unique NameBAP2ALocus_1009_Transcript_2/4_Confidence_0.400_Length_1788
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length1788
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1009_Transcript_2/4_Confidence_0.400_Length_1788 ID=BAP2ALocus_1009_Transcript_2/4_Confidence_0.400_Length_1788|Name=BAP2ALocus_1009_Transcript_2/4_Confidence_0.400_Length_1788|organism=Venturia canescens|type=mRNA|length=1788bp
ATTTATCTGCTCGCGTCAGCGTCATCAATATGCGGCAAGTTTGAGAAACC
GAAATTTTCATGTTGCCCCAGAAATTCTTCAACGATCAAATTCAAATAAT
CTGTATTAATACTTTTTTACCAGAAAAAATCAACGTGCGTTTGCTATCGT
TGAGTAGCACAAGACAATGGGAGTGGTGCACTCGATCAGAAATATCCGAG
CTAGCAAAAGGGACATAAATATTGAGAGTCTACTGTACAATGACAACACA
GCTCTCCGGCAGCCACATCGCGGTCGGAGTCCACGTTGAGCGCTCCCTTC
CCTAGGGGATTTTAGTACACAGTCCGTACGAGTCGCACGAGCGGTACGAT
GAATTCTCATTCCCCCCACTCGGAGAGACCATAGGAATGCGCGCGGGTCT
CCGGGTAATTATTGTCTGGATATATTCCGAGCCAACATTGCGAATACTCC
GGTGAGAATTTGAAATTCACATTGAACGAGAAAAATAAAGTAAAAAAATC
GTAAAATTTGCTTTGGTTCAACGGCCCGAAATAGCAAGCAAATATAAGTA
AGCGACGGAGTAGTAAGAGAAGTAGATGAATGAAGGCATCAAAGCTTAAT
ATTAAGGCTTTCGGTCCCCTTCGTTAGGCGAATCATGATTATTCGCAATA
AACATGATAAGCGCGTTGGACAGCTAGAGAAAACGGCGAGTCGCGATTTC
TGCGTCGAATTTCCAAAAAAGGCCACGAAGCGCTGATTCACGCGTTCGTG
TTGTGATCGCCTTCCCACGAGTATTCCCATATACAATAAAAAAAATCCTT
CCAAGTGTATATAAATATAAAAAAAGAGCACGCGGAGTGGCTTAAAATAA
AGAAGACGTAATAGTTCGAACAGTTCGTTTTCTAGGCTCGATGTACAGCC
TTATAACGAAGCATTGAATAAGCGCCTCAACACATATACATATCGACATC
CCGATTCTAAAGACCACACAGTTTCTAGGCGCTCGTGTAAAGGAGCGATC
GATACACAGGCTGGGCTTTCATGAATGACGTAGCTTTAATCTGTGCCATT
TGCGACGCAAGAGGAAAAAATAAAAAGCAATCCTACCCGTTTTTGGGAGC
GTCTGTTCTCCGCGTCAATTCTTCACGTGGGAGTCAATGTATTCTATAAT
ACGCGTATATATACGTGAGTTGATGGGATTCGAGAACATGCTCGTGGCTC
TTGAAGTTTTAAACATTCGTGTGCGCGTATAGATATATATCGCGAAACAG
TAATCTTTATTTGAACTTTCACATGTTTTTTTTGTCTCTCTTTCGCATTC
CCTCCCCTCTCTCTCCTTTCCTCCCTCCCGCGGTCCTCACAAACGAGCCG
GCAACGTCGCACAACGGAAGTGGGCACGTAAGCAAGATACAGATATGTAT
CGCGTTGTGTGTCCCGCAGTACAAAGCCCGTTGGCTGTTCTTTGTGCTAT
AATGCCAGACGGCAGCAAGGAGAAGCGAGCAGGACTCTCTTTTCGGTTTT
CAACAGGAAGCCACTTTCGAAAAGATAAACTATACGTATGGAGATATATT
ATCGTGCATGGATATATATGTGAGCTCGATGTTGAGGAAGAATGAAAAAA
ATAAGGAAAAATAAAGAATAAACAGATCCGTTTTGAAGGTTATGTAACTG
CTGAAATTTTTCGACTGGGTTGTTTGCGCGTGATATCGCATAGTCGCCCG
AGGAGCGTCTTTGTATTCGATTGTAATGCTTTTTTTCCAGTTGTCTTATC
TAACGAGGTTTTCAACATCTCGAAAAGTAGAGGATATA
back to top