BAP2ALocus_1009_Transcript_3/4_Confidence_0.600_Length_2406 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1009_Transcript_3/4_Confidence_0.600_Length_2406
Unique NameBAP2ALocus_1009_Transcript_3/4_Confidence_0.600_Length_2406
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2406
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1009_Transcript_3/4_Confidence_0.600_Length_2406 ID=BAP2ALocus_1009_Transcript_3/4_Confidence_0.600_Length_2406|Name=BAP2ALocus_1009_Transcript_3/4_Confidence_0.600_Length_2406|organism=Venturia canescens|type=mRNA|length=2406bp
CTCTTGTTCTCTTCATGTATATGATGCTCTTCGCCTCCTTCCCTTGAAGG
TTTTCGTTTATTATGAAAATAATTGAGAGAACGTACAGAGTCGGAAATGA
AATTTTAAAAACTATTGAACAGTGTAATGTTTTTCAAATTCCATGTTTTT
GTTCGAATACACAATTCGCGCACTGAACTTATTTTAATCGATTACGCGTG
TGCCCGGACGGAAATACCGAAATGAAGTCTCATCGACGGATAGTTTTTCT
ACTACGCGGACGGCGCTCTGACGGGAAAAGAGAGCGATGGAAGAAAAACG
AGACAGAGAATGGGAGTGAAAGAGATAAAAGATATCCCGTAGTTCCCAGA
ACGGCAGGGCACTCGAGAAACTCTGAGAAGCGACCTCGTGGTCACAATCG
TGGCTCGTATTCACAGTCCTGCCCCACAGCTGTACACAGCTCGTTCACCC
GCCTATGTGTGTGTCCATGTCAATGTATGAACGCGCGCAACGTTGCCGCT
TGTACGCCGAGTTTCCCATGGCCCCGTATTTTTTTCCCACTACGATCTCT
TGTTACTCTTCGTATCTACAGTTCATTTCCGATTAGCGCGAAGGTCGAAA
GTCGAAGTTTTCGTTCTTGTGATTGTTTCAAACTTCGAACTTTTTCTATT
CGGACATTTTTGAAATATTGTTCATAAGCGAAATAAAATGTACGAATCTA
ACGGGCCATTTATCTGCTCGCGTCAGCGTCATCAATATGCGAAAAAATCA
ACGTGCGTTTGCTATCGTTGAGTAGCACAAGACAATGGGAGTGGTGCACT
CGATCAGAAATATCCGAGCTAGCAAAAGGGACATAAATATTGAGAGTCTA
CTGTACAATGACAACACAGCTCTCCGGCAGCCACATCGCGGTCGGAGTCC
ACGTTGAGCGCTCCCTTCCCTAGGGGATTTTAGTACACAGTCCGTACGAG
TCGCACGAGCGGTACGATGAATTCTCATTCCCCCCACTCGGAGAGACCAT
AGGAATGCGCGCGGGTCTCCGGGTAATTATTGTCTGGATATATTCCGAGC
CAACATTGCGAATACTCCGGTGAGAATTTGAAATTCACATTGAACGAGAA
AAATAAAGTAAAAAAATCGTAAAATTTGCTTTGGTTCAACGGCCCGAAAT
AGCAAGCAAATATAAGTAAGCGACGGAGTAGTAAGAGAAGTAGATGAATG
AAGGCATCAAAGCTTAATATTAAGGCTTTCGGTCCCCTTCGTTAGGCGAA
TCATGATTATTCGCAATAAACATGATAAGCGCGTTGGACAGCTAGAGAAA
ACGGCGAGTCGCGATTTCTGCGTCGAATTTCCAAAAAAGGCCACGAAGCG
CTGATTCACGCGTTCGTGTTGTGATCGCCTTCCCACGAGTATTCCCATAT
ACAATAAAAAAAATCCTTCCAAGTGTATATAAATATAAAAAAAGAGCACG
CGGAGTGGCTTAAAATAAAGAAGACGTAATAGTTCGAACAGTTCGTTTTC
TAGGCTCGATGTACAGCCTTATAACGAAGCATTGAATAAGCGCCTCAACA
CATATACATATCGACATCCCGATTCTAAAGACCACACAGTTTCTAGGCGC
TCGTGTAAAGGAGCGATCGATACACAGGCTGGGCTTTCATGAATGACGTA
GCTTTAATCTGTGCCATTTGCGACGCAAGAGGAAAAAATAAAAAGCAATC
CTACCCGTTTTTGGGAGCGTCTGTTCTCCGCGTCAATTCTTCACGTGGGA
GTCAATGTATTCTATAATACGCGTATATATACGTGAGTTGATGGGATTCG
AGAACATGCTCGTGGCTCTTGAAGTTTTAAACATTCGTGTGCGCGTATAG
ATATATATCGCGAAACAGTAATCTTTATTTGAACTTTCACATGTTTTTTT
TGTCTCTCTTTCGCATTCCCTCCCCTCTCTCTCCTTTCCTCCCTCCCGCG
GTCCTCACAAACGAGCCGGCAACGTCGCACAACGGAAGTGGGCACGTAAG
CAAGATACAGATATGTATCGCGTTGTGTGTCCCGCAGTACAAAGCCCGTT
GGCTGTTCTTTGTGCTATAATGCCAGACGGCAGCAAGGAGAAGCGAGCAG
GACTCTCTTTTCGGTTTTCAACAGGAAGCCACTTTCGAAAAGATAAACTA
TACGTATGGAGATATATTATCGTGCATGGATATATATGTGAGCTCGATGT
TGAGGAAGAATGAAAAAAATAAGGAAAAATAAAGAATAAACAGATCCGTT
TTGAAGGTTATGTAACTGCTGAAATTTTTCGACTGGGTTGTTTGCGCGTG
ATATCGCATAGTCGCCCGAGGAGCGTCTTTGTATTCGATTGTAATGCTTT
TTTTCCAGTTGTCTTATCTAACGAGGTTTTCAACATCTCGAAAAGTAGAG
GATATA
back to top