BAP2ALocus_1019_Transcript_1/5_Confidence_0.222_Length_525 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1019_Transcript_1/5_Confidence_0.222_Length_525
Unique NameBAP2ALocus_1019_Transcript_1/5_Confidence_0.222_Length_525
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length525
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1019_Transcript_1/5_Confidence_0.222_Length_525 ID=BAP2ALocus_1019_Transcript_1/5_Confidence_0.222_Length_525|Name=BAP2ALocus_1019_Transcript_1/5_Confidence_0.222_Length_525|organism=Venturia canescens|type=mRNA|length=525bp
TTTTTTTTTTTTTTTTTTTTNNNTGTTTGTTTTTTTTTTTTTTTTCCATT
GCGTCAATAACGGATATATTTTGTATGGAAATACGCCGGCCATTAAACTC
CTAATCGTGTATCTGTGTCTCCAAAATTACCTATAATCGTTCGATGTTAT
GAAAAAAATATTAATCAACATAATCGAATACATTCGAGCGACATGAAAAA
TATTGTAATTCACCAGCGTCTAATTCAACAGCCGGTGTATATTCGGTCAA
TTGACGTGAGGCGCATCAAACGAGTGTGATAAACGTTGAAATACTTGTGC
TGCTCGATAATCGTGTGATAATGTTACGATGGAGACGCCGCTATGGAAAT
GAATTGTTAAAGAAAAGAGCGTGCGAATAACACGATAATATTTCACTTGT
GATTTTTTACACACGGATAATATTCTTTGTACAATAATATATCTGTGATT
AAGACAATTTATACATTTGAATGTGTATACATGCTATCAGACGTGAAAAA
TATACGTACGTACTTCAAACCGAAG
back to top