BAP2ALocus_1019_Transcript_3/5_Confidence_0.333_Length_1182 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1019_Transcript_3/5_Confidence_0.333_Length_1182
Unique NameBAP2ALocus_1019_Transcript_3/5_Confidence_0.333_Length_1182
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length1182
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1019_Transcript_3/5_Confidence_0.333_Length_1182 ID=BAP2ALocus_1019_Transcript_3/5_Confidence_0.333_Length_1182|Name=BAP2ALocus_1019_Transcript_3/5_Confidence_0.333_Length_1182|organism=Venturia canescens|type=mRNA|length=1182bp
ATCGCACTTTTGCGTTTCGTTATTCCGCAATAACCGAGGTCTGACTCTGA
TTAAGGCGTAACGTCTGCTGCGCTAATCATTATTTTTTCTCCTTTTCTCA
ATCCAGCAATACAAATCTACTTCTGGCAAGTCGTCTACAGTCATTACAAG
GAGCTGGTAGCGGAGAAATTCGGACACCAGACGCGTCCATCGGACGGAAA
AGTCTTCGGCGTGGCGCCCTACCTCCACGTTTAAGATTCGCCCAAAAGTG
TACAAATGCTTCACCGCATACTAAAACAACCACTCGATTCCAAACGAAAT
TCATTGAGAACGACCAAGCTCGGTATTTTTTGTAAAACGAAGACTAGCGT
CTTGAAAAAAACAACAATGATTTTTTACGTTCACTTTATTCATAGTTATA
TCTACATTACTCTTTACAATCAGCGAACAATATTTTTTATACGGAAAGTC
TTGATGGTACGATAAGTACGGACGTCGAATATTTTTTCAAGGGCCGAAGA
AAAACATTATCCGATCCGATTTTTTCTTTTCGATAACGTGATAAATTTAT
CGAAATTTGCAAAGACCTTTAGCTAGATCGTAAGCTAGATCGGCCAATTT
TCCTCGCTATTTGAGATTCGGGTATCGTCCTTCGTGTCAAATGTAAAAAG
AATCGCAATTAGTACGTTCGTTGCGTTCATTTGTTTGTTTTTTTTTTTTT
TTTCCATTGCGTCAATAACGGATATATTTGTATGGAAATACGCCGGCCAT
TAAACTCCTAATCGTGTATCTGTGTCTCCAAAATTACCTATAATCGTTCG
ATGTTATGAAAAAAATATTAATCAACATAATCGAATACATTCGAGCGACA
TGAAAAATATTGTAATTCACCAGCGTCTAATTCAACAGCCGGTGTATATT
CGGTCAATTGACGTGAGGCGCATCAAACGAGTGTGATAAACGTTGAAATA
CTTGTGCTGCTCGATAATCGTGTGATAATGTTACGATGGAGACGCCGCTA
TGGAAATGAATTGTTAAAGAAAAGAGCGTGCGAATAACACGATAATATTT
CACTTGTGATTTTTTACACACGGATAATATTCTTTGTACAATAATATATC
TGTGATTAAGACAATTTATACATTTGAATGTGTATACATGCTATCAGACG
TGAAAAATATACGTACGTACTTCAAACCGAAG
back to top