BAP2ALocus_1019_Transcript_4/5_Confidence_0.556_Length_2284 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1019_Transcript_4/5_Confidence_0.556_Length_2284
Unique NameBAP2ALocus_1019_Transcript_4/5_Confidence_0.556_Length_2284
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2284
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1019_Transcript_4/5_Confidence_0.556_Length_2284 ID=BAP2ALocus_1019_Transcript_4/5_Confidence_0.556_Length_2284|Name=BAP2ALocus_1019_Transcript_4/5_Confidence_0.556_Length_2284|organism=Venturia canescens|type=mRNA|length=2284bp
CTCAGCCTTGCAATAAATTACCCAACCTCTTACTCTTCCTCCTATAAACT
CACACATTTTAGAACTGCCTGGAGCAAGAATCGACGAAAAAATAATTCGT
TTCGATCGGTGTATTTCGGGCGTAAAAAAAATGGTTCGGTATGAGTGATA
AACTATGAGCTTTCGAATACATTCTTTCGACTCGACTCAGGCGAACTGAT
ATCAAACAGATGTGAGACGCTGGGGCGAATAAATCTTCGTTTTTTCATTG
TTATCACGTGTATAAAAAAACGAGATGTAAAGAGAGTAAATTTGAGTAAA
TTTATCGTGGTTTGTCAAGAATCGTTTCCGCAGTTGTCGAAAAATTTGAT
CTCTTGTCGAGCCTACGTTTTTCAAGGGAATCTTTAAAACGGTTTTGCTA
AACGAATCGAAATCTCGATTAGAAGTGACTCGCGCAAAAACTCGAGATGC
GTCAACTTAGTAATTGTTCAATCAACCCACAAGTGTAGGTACTCGCTCGA
TGAACAAGGCTGCTGTTGAATGAATACTGCAAACTCCATTCAACTGTATT
TGTCGTTAAATTGACGCAGAAGAAAATGACTGAGGCTGCCCAACAGCGTG
CAGTATTTGCGAAAATGTAATTTAAAGCGTTTTTCAAGTCTAGCCAGCAG
ACGAAACGAACGTAATTATTTATTCGACGTTGTTTACGGACAAAATATTG
GACACGTGACTGTCACGAAGGAGAGAAAACCACGAAGGTCCTCGAGCTCG
TTTTCATTGGATGCACTTATCAAAAATATTTTTGTCACCTAATTCCTCAA
TGTCATTTCAGATTCTGGTTAACTCTTGCTGCGGTTGCATCTCTTTGCAA
ACAGTCGTGATCGGCTCCTTGTCACTGATAGGAGCGATTCTGAACACGAT
ACTGATGGGATTTCACGTGAGCGAAATCAGCGTGCCGAGAGAAAGCCCAG
CCACGGCCATCGTCGTTCTCCTCAAAATTTTCGTCGTGACCATCTTAATA
TACGTATTAATCGGAGGAATATTCTCTGCGCTTATGATCGCGGGTGCGAT
CAAGAGGCTCTCCGGCTACATCTTTCCCTGGCTCGCAATTTCCTTCGGAG
GTGTCGTAGCTGGCGTTTGTCTCACAATTGCAGTGAGCATAATCTCCGCG
ATAGAACTCCCGATCCAGTATTTTTTTTTCCTCATGATATTCTCGTCAGT
GAGTTCGGCAATACAAATCTACTTCTGGCAAGTCGTCTACAGTCATTACA
AGGAGCTGGTAGCGGAGAAATTCGGACACCAGACGCGTCCATCGGACGGA
AAAGTCTTCGGCGTGGCGCCCTACCTCCACGTTTAAGATTCGCCCAAAAG
TGTACAAATGCTTCACCGCATACTAAAACAACCACTCGATTCCAAACGAA
ATTCATTGAGAACGACCAAGCTCGGTATTTTTTGTAAAACGAAGACTAGC
GTCTTGAAAAAAACAACAATGATTTTTTACGTTCACTTTATTCATAGTTA
TATCTACATTACTCTTTACAATCAGCGAACAATATTTTTTATACGGAAAG
TCTTGATGGTACGATAAGTACGGACGTCGAATATTTTTTCAAGGGCCGAA
GAAAAACATTATCCGATCCGATTTTTTCTTTTCGATAACGTGATAAATTT
ATCGAAATTTGCAAAGACCTTTAGCTAGATCGTAAGCTAGATCGGCCAAT
TTTCCTCGCTATTTGAGATTCGGGTATCGTCCTTCGTGTCAAATGTAAAA
AGAATCGCAATTAGTACGTTCGTTGCGTTCATTTGTTTGTTTTTTTTTTT
TTTTTCCATTGCGTCAATAACGGATATATTTGTATGGAAATACGCCGGCC
ATTAAACTCCTAATCGTGTATCTGTGTCTCCAAAATTACCTATAATCGTT
CGATGTTATGAAAAAAATATTAATCAACATAATCGAATACATTCGAGCGA
CATGAAAAATATTGTAATTCACCAGCGTCTAATTCAACAGCCGGTGTATA
TTCGGTCAATTGACGTGAGGCGCATCAAACGAGTGTGATAAACGTTGAAA
TACTTGTGCTGCTCGATAATCGTGTGATAATGTTACGATGGAGACGCCGC
TATGGAAATGAATTGTTAAAGAAAAGAGCGTGCGAATAACACGATAATAT
TTCACTTGTGATTTTTTACACACGGATAATATTCTTTGTACAATAATATA
TCTGTGATTAAGACAATTTATACATTTGAATGTGTATACATGCTATCAGA
CGTGAAAAATATACGTACGTACTTCAAACCGAAG
back to top