BAP2ALocus_1019_Transcript_5/5_Confidence_0.444_Length_1713 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1019_Transcript_5/5_Confidence_0.444_Length_1713
Unique NameBAP2ALocus_1019_Transcript_5/5_Confidence_0.444_Length_1713
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length1713
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1019_Transcript_5/5_Confidence_0.444_Length_1713 ID=BAP2ALocus_1019_Transcript_5/5_Confidence_0.444_Length_1713|Name=BAP2ALocus_1019_Transcript_5/5_Confidence_0.444_Length_1713|organism=Venturia canescens|type=mRNA|length=1713bp
TATAATCGATTCGCAAGGACTCCGCTGCGGATGCGTTCGACTCGTAGAGA
GACGCTGAGATCGTACAGCGCAACTACAGTGATGAACCAGTTGTTGCCGT
GAACAGCCACGAGGAGGTATATTTGGTCGTGAATTTCTGCTGTGGCATTG
TACACTTCGCCTGGGTCTTGCCGTGACCTCGTGCTATTTTTGTCGTCATC
TTCCCGAAGTTCTTCCTCATAAATTTATAAAATGATTCTGGTTAACTCTT
GCTGCGGTTGCATCTCTTTGCAAAAAGGAACAATCGTGATCGGCTCCTTG
TCACTGATAGGAGCGATTCTGAACACGATACTGATGGGATTTCACGTGAG
CGAAATCAGCGTGCCGAGAGAAAGCCCAGCCACGGCCATCGTCGTTCTCC
TCAAAATTTTCGTCGTGACCATCTTAATATACGTATTAATCGGAGGAATA
TTCTCTGCGCTTATGATCGCGGGTGCGATCAAGAGGCTCTCCGGCTACAT
CTTTCCCTGGCTCGCAATTTCCTTCGGAGGTGTCGTAGCTGGCGTTTGTC
TCACAATTGCAGTGAGCATAATCTCCGCGATAGAACTCCCGATCCAGTAT
TTTTTTTTCCTCATGATATTCTCGTCAGTGAGTTCGGCAATACAAATCTA
CTTCTGGCAAGTCGTCTACAGTCATTACAAGGAGCTGGTAGCGGAGAAAT
TCGGACACCAGACGCGTCCATCGGACGGAAAAGTCTTCGGCGTGGCGCCC
TACCTCCACGTTTAAGATTCGCCCAAAAGTGTACAAATGCTTCACCGCAT
ACTAAAACAACCACTCGATTCCAAACGAAATTCATTGAGAACGACCAAGC
TCGGTATTTTTTGTAAAACGAAGACTAGCGTCTTGAAAAAAACAACAATG
ATTTTTTACGTTCACTTTATTCATAGTTATATCTACATTACTCTTTACAA
TCAGCGAACAATATTTTTTATACGGAAAGTCTTGATGGTACGATAAGTAC
GGACGTCGAATATTTTTTCAAGGGCCGAAGAAAAACATTATCCGATCCGA
TTTTTTCTTTTCGATAACGTGATAAATTTATCGAAATTTGCAAAGACCTT
TAGCTAGATCGTAAGCTAGATCGGCCAATTTTCCTCGCTATTTGAGATTC
GGGTATCGTCCTTCGTGTCAAATGTAAAAAGAATCGCAATTAGTACGTTC
GTTGCGTTCATTTGTTTGTTTTTTTTTTTTTTTTCCATTGCGTCAATAAC
GGATATATTTGTATGGAAATACGCCGGCCATTAAACTCCTAATCGTGTAT
CTGTGTCTCCAAAATTACCTATAATCGTTCGATGTTATGAAAAAAATATT
AATCAACATAATCGAATACATTCGAGCGACATGAAAAATATTGTAATTCA
CCAGCGTCTAATTCAACAGCCGGTGTATATTCGGTCAATTGACGTGAGGC
GCATCAAACGAGTGTGATAAACGTTGAAATACTTGTGCTGCTCGATAATC
GTGTGATAATGTTACGATGGAGACGCCGCTATGGAAATGAATTGTTAAAG
AAAAGAGCGTGCGAATAACACGATAATATTTCACTTGTGATTTTTTACAC
ACGGATAATATTCTTTGTACAATAATATATCTGTGATTAAGACAATTTAT
ACATTTGAATGTGTATACATGCTATCAGACGTGAAAAATATACGTACGTA
CTTCAAACCGAAG
back to top