BAP2ALocus_1021_Transcript_2/3_Confidence_0.714_Length_2120 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1021_Transcript_2/3_Confidence_0.714_Length_2120
Unique NameBAP2ALocus_1021_Transcript_2/3_Confidence_0.714_Length_2120
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2120
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1021_Transcript_2/3_Confidence_0.714_Length_2120 ID=BAP2ALocus_1021_Transcript_2/3_Confidence_0.714_Length_2120|Name=BAP2ALocus_1021_Transcript_2/3_Confidence_0.714_Length_2120|organism=Venturia canescens|type=mRNA|length=2120bp
TCAAGTGGGATTTTTCGATTCCACGGCGTTTTAACACTCAAAATCAAAAC
GTACGTTCGTGAGTTAATATTTCCCCCTTAAACGCAGAAACACAAATAAA
ACGAAATATAGCAATAAACATGCATGTGCGATAAAGAGCAGGAAAGAAAT
GTCCCTGGACGCATATCATCATTCGTTGCTATCAACGAGTATAAATTTCA
AGAAATTCGTGAGGGAATCGGACAGCAATCCTGAGGGAGATGAATCGTCG
GAGAAGAGAGAATTAAATTTTAGAGGTAACGAAGCGCGGATAGCTTACGA
GGAAATTATAAATGATCGCGTAGGTGATGAGAAAAAGAAAAACAATCGTG
ATAAGCGAAGAAGGAGCTCGCATTCTGAGAGAGAGAAACTAGAAACGCGT
GATCGCGATAAACCGAGAGAACCGCGTAAACACACTACAAGAATAACAGC
AAACTGTGTTTTAAAGGCGGTTGAAAGTGGGGATTTGAACTTTTTGGAGC
GTAACATAACGTCAGTGAACGTAAATATTTCGGATGATTATGGGTGGACG
CCGTTAATGTCAGCTGCCTTTTGTGGCAATTACAAAATCGTTGATTTTCT
ACTAAAATTGGGAGCAAACACACGTTGCCGCGACAAGTCTGGCTTTACAG
CAGGTGGACTTGCCTCAAAAAAAAATTATTCTGGTATCGTAGCATTACTA
AAAGAGAAACAATCGTCAAGCAACCCGGAAGCTTCGTCGTCTACAGTATC
CAGTCCTCGAAAAGATTCGGATAGAAGGAGGAAAAGAAAGGAATTCTATT
GCACCATTTGCAGAGAAAGTTTTAAAGAAACAACCTTAAAAAAGCACCAA
ACTTCAACTTTACATATTTTCAATACAAAGCCAAAATTGCCGGAGAACGG
ATATTATTCAATTCCAAAGCATAACAAAGGTTACCAAATGTTGCTGAAAA
AAGGCTGGAACGAAGGAGGTCTTGGGCCTGATGCTAGGGGCTCTAAATAT
CCAGTGAAAACAGTGCTCAAAAGAGATCGAAGAGGCTTCGACGAAGGTGC
TAGGACCGAGGCTAGGGTGACACATTTTGGAAGCAGTGATACCAGAGCAG
TTGCTTCTGCAACGAGACAACCGAGAGAAAGAACCCTTAAAAAAAGAGAC
AGAGAGAGATTGCTCAGCAAAGAAGCAAGACGGGAGAGAGCTTTTAGGAG
AGCTTTGTCCTAACATCTTCTCCCTCGTATCGTTTTTCTTTCTCGTTTCT
TTTTACATTAAAATAAATCAATAAAAAATCGTAATAATCAAAAAACAAAA
TCACAAATCCTCCTGGGCATTGAGGAATTTCATCGGAAGATCAAACTGTA
CTCGAATTTGATAAGTTAGAATTATTTTAACGATGAACGACCAACTGCGA
ATGTTGAATCATTTGAGACAGGTAGAATCCAAAGCCGCTGAAATTCTGAC
CGATAAACAAGAGGTGATTGACCTTGACAAACGACGAAACGACGATCGGG
TTGGGATGCGAGCTTTGCAGAAAGAACACCACGATAAAACTTGGATTACC
GTGGGACCGATATTGCTTAAAATGGATACTAAGAAAGCTGAGGAATTGCT
CGTCAAAGATCAAAAAGAATGTGACATTGCGGTCAACAAAATACGAAGTG
ATCTCAAAGTGAAGGTCAACGAACTACGCGATTTGGAGCACAATCCACCG
GTTCCTGGGCTCATGCTGAAACCCATGTCGTACAAGGAGATGTCAGCAAT
TAATCAGCTATCCGGAAAAAGTCTATGAGCTACGAGAGGCCCCGTTTCAT
TTTTCTATCGACAATAGTTTGTAATTCTTTGAACTCAACAAATTTTCAAG
AATATTCACAGGCGTTGAAAATGTGAAGCTTATTTCCATAAAGTTTCTCA
ACAATAATCGAAGTACGCCAATATTTCATGAGTCGTATAAACGTCGTACG
ATCTCCATTTATTTTACAGTAGTCAAAGAAAATTTCAACCAATTGTCAAC
TTTTCGTGGCTTTTACAAAAAATTCTATTCTTCGTATCCATTTTTCCAGC
AGTTTTTCATTTACGAATTTCCTTGATTCTGTACATAATAAAACTTAATT
AAAGGTCAAAAAAAAAAAAA
back to top