BAP2ALocus_1021_Transcript_3/3_Confidence_0.714_Length_2105 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1021_Transcript_3/3_Confidence_0.714_Length_2105
Unique NameBAP2ALocus_1021_Transcript_3/3_Confidence_0.714_Length_2105
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2105
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1021_Transcript_3/3_Confidence_0.714_Length_2105 ID=BAP2ALocus_1021_Transcript_3/3_Confidence_0.714_Length_2105|Name=BAP2ALocus_1021_Transcript_3/3_Confidence_0.714_Length_2105|organism=Venturia canescens|type=mRNA|length=2105bp
TCAAGTGGGATTTTTCGATTCCACGGCGTTTTAACACTCAAAATCAAAAC
GTACGTTCGTGAGTTAATATTTCCCCCTTAAACGCAGAAACACAAATAAA
ACGAAATATAGCAATAAACATGCATGTGCGATAAAGAGCAGGAAAGAAAT
GTCCCTGGACGCATATCATCATTCGTTGCTATCAACGAGTATAAATTTCA
AGAAATTCGTGAGGGAATCGGACAGCAATCCTGAGGGAGATGAATCGTCG
GAGAAGAGAGAATTAAATTTTAGAGGTAACGAAGCGCGGATAGCTTACGA
GGAAATTATAAATGATCGCGTAGGTGATGAGAAAAAGAAAAACAATCGTG
ATAAGCGAAGAAGGAGCTCGCATTCTGAGAGAGAGAAACTAGAAACGCGT
GATCGCGATAAACCGAGAGAACCGCGTAAACACACTACAAGAATAACAGC
AAACTGTGTTTTAAAGGCGGTTGAAAGTGGGGATTTGAACTTTTTGGAGC
GTAACATAACGTCAGTGAACGTAAATATTTCGGATGATTATGGGTGGACG
CCGTTAATGTCAGCTGCCTTTTGTGGCAATTACAAAATCGTTGATTTTCT
ACTAAAATTGGGAGCAAACACACGTTGCCGCGACAAGTCTGGCTTTACAG
CAGGTGGACTTGCCTCAAAAAAAAATTATTCTGGTATCGTAGCATTACTA
AAAGAGAAACAATCGTCAAGCAACCCGGAAGCTTCGTCGTCTACAGTATC
CAGTCCTCGAAAAGATTCGGATAGAAGGAGGAAAAGAAAGGAATTCTATT
GCACCATTTGCAGAGAAAGTTTTAAAGAAACAACCTTAAAAAAGCACCAA
ACTTCAACTTTACATATTTTCAATACAAAGCCAAAATTGCCGGAGAACGG
ATATTATTCAATTCCAAAGCATAACAAAGGTTACCAAATGTTGCTGAAAA
AAGGCTGGAACGAAGGAGGTCTTGGGCCTGATGCTAGGGGCTCTAAATAT
CCAGTGAAAACAGTGCTCAAAAGAGATCGAAGAGGCTTCGACGAAGGTGC
TAGGACCGAGGCTAGGGTGACACATTTTGGAAGCAGTGATACCAGAGCAG
TTGCTTCTGCAACGAGACAACCGAGAGAAAGAACCCTTAAAAAAAGAGAC
AGAGAGAGATTGCTCAGCAAAGAAGCAAGACGGGAGAGAGCTTTTAGGAG
AGCTTTGTCCTAACATCTTCTCCCTCGTATCGTTTTTCTTTCTCGTTTCT
TTTTACATTAAAATAAATCAATAAAAAATCGTAATAATCAAAAAACAAAA
TCACAAATCCTCCTGGGCATTGAGGAATTTCATCGGAAGATCAAACTGTA
CTCGAATTTGATAAACGATGAACGACCAACTGCGAATGTTGAATCATTTG
AGACAGGTAGAATCCAAAGCCGCTGAAATTCTGACCGATAAACAAGAGGT
GATTGACCTTGACAAACGACGAAACGACGATCGGGTTGGGATGCGAGCTT
TGCAGAAAGAACACCACGATAAAACTTGGATTACCGTGGGACCGATATTG
CTTAAAATGGATACTAAGAAAGCTGAGGAATTGCTCGTCAAAGATCAAAA
AGAATGTGACATTGCGGTCAACAAAATACGAAGTGATCTCAAAGTGAAGG
TCAACGAACTACGCGATTTGGAGCACAATCCACCGGTTCCTGGGCTCATG
CTGAAACCCATGTCGTACAAGGAGATGTCAGCAATTAATCAGCTATCCGG
AAAAAGTCTATGAGCTACGAGAGGCCCCGTTTCATTTTTCTATCGACAAT
AGTTTGTAATTCTTTGAACTCAACAAATTTTCAAGAATATTCACAGGCGT
TGAAAATGTGAAGCTTATTTCCATAAAGTTTCTCAACAATAATCGAAGTA
CGCCAATATTTCATGAGTCGTATAAACGTCGTACGATCTCCATTTATTTT
ACAGTAGTCAAAGAAAATTTCAACCAATTGTCAACTTTTCGTGGCTTTTA
CAAAAAATTCTATTCTTCGTATCCATTTTTCCAGCAGTTTTTCATTTACG
AATTTCCTTGATTCTGTACATAATAAAACTTAATTAAAGGTCAAAAAAAA
AAAAA
back to top