BAP2ALocus_1022_Transcript_10/12_Confidence_0.225_Length_4324 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1022_Transcript_10/12_Confidence_0.225_Length_4324
Unique NameBAP2ALocus_1022_Transcript_10/12_Confidence_0.225_Length_4324
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length4324
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1022_Transcript_10/12_Confidence_0.225_Length_4324 ID=BAP2ALocus_1022_Transcript_10/12_Confidence_0.225_Length_4324|Name=BAP2ALocus_1022_Transcript_10/12_Confidence_0.225_Length_4324|organism=Venturia canescens|type=mRNA|length=4324bp
TTTTTTTTAAATGACAATATATTAATTTATTGAAAATAAAACCAATATCT
ATACAATTCTCCAAAGCTTAAATAATTATAAAGGTGTTTTCATTATATAA
GTAACGATGAAGTAGATAATCGTTGTCCAAATTTATCTCAACGAAACTTC
TTTAAAGTTCTTATCGCAAATTTGTCGAGTTCTATAACTTGAATAATGGA
CGAAAGATCAACAACGGAAATGGGATGAAAAATATGAAATAATCTCAACA
GTCCTTATTGTTAAAATTCTCCTATACCTTTTCGTATATGGGGTATATTT
TCCTAAGGGAATTTCATGTAAAAAGTCCTAGCCTACTATGCAAAAATTCC
TTTACTCGAAATGCTCACCTTTTTGAATTTATTACCTACATTGTAGAGTT
ACCCGCGATTTTGTAACGTTGCGAAAATCAATTTCAAATTGTTTGGAATA
TCTAGCTACGGCCGAATACAAAATATTTTACATACGATCCTTTTCTATAC
GAAAGAAAATCAATCACGCGTCGGTGAATGGAGGTCTTTTTGAGGTTTTT
TCTATTATATGTATGTATATTCGCTCGTGTGACAGCAGGGAATCGTCTTA
TCGCAACACTACACTTTTTATTCCACTTCAATTACTTTTCCAGAATGTGC
AGTGAGCATTTTCAACGCAAGTTTAAGAGCGTTCGATTTATCTGTTCGTT
ATATTTACACCACAGATAACTTATCGTTTAATTAGGCGCTTTTAAGGCGG
TTCAAAAAAATTTTGATTAAAGAAGAAAAAACTGTGCCCTCACGATTTCT
TGAAATTTACGTTATTTTAAAACGGCAGAAAAAATTAATAATTTTTCGAC
ATAAAATGCAGCATATTGAAGAGGAATTTTTTTCCTGTTTATACAAGCAA
AACCGTTGCTTAATATTATCAAAGTAGCCAACTGATAAAAATTTCGAATG
CAAACTTTGAAATAACAGCCTCAATTGGTTAAATTGATTTCATGAATATT
TCTTAATTAGTTTCTTGAGAAAAGATTACTGTGATTCGACTCTTAAGTCA
ATGTATTCTGATCGAATACGGAAACAAGTGTACTCTCATGTTATTTTAGG
GAAAATATTGCCAATTGCGCTGAAAAAGTATTAGTAAAATCGAAGCTCTT
TGATGAGAATTCGACATTCTTTAAATAACTAATTAACAAATCTCGTGGTT
GACTTTCCAATAGTATTTGATTATAGAATTCCTGTTTCTCAGTTTTAACT
TTATATTAAACTAACTTTGAACCTAAATAAAACCGTTCATTTTTTGGAGA
AACATTTTTTAAAATATTAATATACGTAGTTTGTAGGTTTTATACATATA
CAAGAGCTGATCAGGAGCAGTTGAAGCAGAAATCAAAGAAATTTTTGTTG
CTCTTTGAAATTGTTGTTCTTTGAAATATTTTTAGTCTTCTAATTTTGGA
ACAACTTGAAGATTTTCACTACATTTGGAAATGTGTAATCGATGGAAGTT
TTATTGATTAACAAACTTTTAATTCGTTGTTTGTTTTTTTCGAAAGATGA
AAGTATTTAGAAATTTTAGCGACAGGAAAATTGTTGAAGATGAATTCACA
TTTGTACTTTCAAACTTCGAAAATATTAATAATATAGAGGACATAATCTC
GAATCATACGACAGAATTGATCAATCAGCGTTTTTAACTCTTAAGGAAAT
TCAATGACGTGTCGTCAAGTCATACTTAATCTTAACGCGAGACTTAATCA
TACGTAAGAGTCAACATTTGCCTTTTTTTCATTTTTCGTTCCTTATAGTC
TATTTTTCGATTCATCTATCTATAAACCATGTTGATGAACGAACAAAAAG
TTCAGAGAGAGAAATACCATTCCAAGGTATTTCGAGGCGTCTCAACAATC
GAGTCAATGATTTTTTTTTTTTTTTCGGGTAAAGAATAATTCTGAACAGG
AAAGAATTCTATTCTAACTCAACGTTGCTGGACAAAAATAGAGATAAACA
TAGATTTTTCTTATTTTTGAGCCACGAGTCCGCCGTTGATTGAACTAAAT
ATTTTTGAATCTATTACTTTGGAATAATGAAAAACAAAGATTCCATCTTT
AATATACGAAGGGCGAGAATGTGGATAAATTTCTCGAGTATAGTGACGAA
TCACGCAATTAAAAATTATCCTCTCGAAGTTTTTTGCCTGCGGGTGTTTT
CGTTTATTTTCTGTTTCCCGAAGGATAATATTATGAGAATCTTGAGGAAA
CGCAATCGTAGAGACGATTCCTAAAGTCGTGAGATCATTTTCCCGGACAA
CTTCTCGAACACGCCCTCAGCTGGTTTCCTTGTTTTTGGGAATCGCTGTC
CTCGTCGCTGCAATCTTCGTCGTGCGTGTGCGTCACATTGCGCGGAGTTT
CTGGACGAGCGTGTGGAATTTGATTGTTCGCAGTGGCACTCTCTATTTCC
AATGGTCTCTGAGCGATAAGTCGATTCTGTTCTTCCTCCTCGTCAGTGAG
CTTGAAGGTCCGTGTTCTACTGATCATCGGTGTTTCCATAACGAACCTTT
GTTCATGAGCTACTGTGCTTTCATGAGGCATCAGCATGGCCGGAGCTCGG
AACATGTAGGAGAATGGATAGTAGATGAGATTGAGGAAAGTTGCAGCGTA
CAAATCAGCATACCTAACAACTTGACTACTGAAAAAAGTTTGTCGGCTTC
CGCTTCGAAAGAGGGATCCCATCATACCGTATGCAAGATCCATTTTGTGA
GTGACGTCCCTTATAGACGCCCTTAATTTCGATATATCAGGTTTTTCTTT
GGTGCTGCTGTCAAGATTTTTGTACATCTCTCCGAGCATTACGTCGAGGC
TTTGAAGTTCAGCAAAAAGTTGACATTTGTCTGTCCAAACGTGTAATTCT
TGTACGAGTTCCGGCACTATCAGGAACGTTCTCCAGCCTCGAATTTTTTT
GCTTTTCAGGATATCACCGAAAATATGATCTCCTATGTAAAGCACGTCTT
TGCCTTTTGCCCCAATCATCTCGGTGAAAACGTCGCACGATCCTCCCGAG
TAAACTTCACCCGTATGAAGGGGTCCTTTGTGCGTACCAAGTTTCAAAGC
ACCAGTTTTCGTATTGACTTGTCTCAATATCGTGCCTTCACCGAAAAACA
GAGGTTTCGTAGCGTCAACGACAATGACGTCGAAATAAGTTTTCCAGTTT
CTGTGAGGTTCATCGGGCCTAGCTCCGTGAGGAAAATCGAATAAGTACGT
CATTATTTTATCGGTGAATACGTAATCGCTGTTCGTGAGTAAAAAAACTT
TAGCTCCGCTCTCACGTATCCTGGTAAGGAACATGGGCAGCCTGTCGTCC
TTCTTAACGTATTCGTCGATTTTCTCGACGGTTTTACTCTTGAGATCGCC
CTGTATGTGAATCCAGTCGACGGCGTTTCTCACATCTTGGAATATACTCT
TGAAGCTCATCGTCAATTCACCCTCTTTAACTCCAGTCTTTTCGCGCGTG
TATTGCGGCGAATTCGTGAAGAAATCAATCAGGCACGCGAGCAAATAAGT
TTCCGGCAAATTGAATAGTGTATTGAGCACGTACACACGGGATTCGTCCA
GCTGGAGAAACTTGTTCGGATAGAGCTCATATACCTGCGAATGCTTCAAG
AAATCGAAACCGTGAACACACACGAGTATATTTCCGTAGGCATCGACTTT
TAAAAGGTTCCCGTAGAGCGTGTCAAACCATAATCCTCTCACTGGAAAAC
TGGGATCGTATTCGAAAGCCTGAATTTCTCGTGGATAACCCAGAGAGACT
AAACGGTCCTTCAAGAGATTGAAACCGAGCTGCTCGTACTGCGGTGATTT
GTACTCTGCCAAAGTGTAGTCCATATCGAAGCCATAGAACTTGATATTCT
CCAGATGGAGACTTCTGTTGACAAATATTCTTTGGCTGGCTTGACGGTAC
CACTTTTTATGACCGCTGGGATCTTCGTGATGAGGCGAGGAGGCTGCCGA
GCTCAGTTGCCCCGGATTACAATTTTCCAGTTCCATGATCAGCTAATCGT
ATAGGAATTAGTGCTTAATCCTCGTAGGTCCAAAGTCCTATTATTTTGTA
TCGCGGATAATATCGATATAAAAATGAACGAAAAATGAAAGAAAAAAAAA
CAAGCACAACGTGTCCAATGTTTTCGGTGTAGTGCGTCGACTTCGGTAAG
CAATCTACTTCTGATTGTTCCAACGATCGTCCAAGAGGAACACACACGGG
CTACGGCCTGTCACACCAAGCAATTCGATGAATATTCCACTCCCTCGTAC
CCCACCCACTCAAGCCCAGCAAGC
back to top