BAP2ALocus_1022_Transcript_11/12_Confidence_0.125_Length_4280 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1022_Transcript_11/12_Confidence_0.125_Length_4280
Unique NameBAP2ALocus_1022_Transcript_11/12_Confidence_0.125_Length_4280
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length4280
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1022_Transcript_11/12_Confidence_0.125_Length_4280 ID=BAP2ALocus_1022_Transcript_11/12_Confidence_0.125_Length_4280|Name=BAP2ALocus_1022_Transcript_11/12_Confidence_0.125_Length_4280|organism=Venturia canescens|type=mRNA|length=4280bp
CTCATTTTAACTGGCGCGGTGCAACAGCTGCCGCGCTGCTGTTCATCTCA
CGCTTTAATTTTTGTTTACTCATTTTGTAGATCACGAAGCGAGTTTACTG
TCCAAAGTAAACTGTGCAGTGGAGGAAAATGAATAGATTAACGATAAAAA
AGTTAACCGGGATAAAAATGGTCGTTTTGTAACAGACATTTGCAGTGTAA
TCTGAATGATTTCTCGTCAGATATTTCTTCATATAGTTGAGCCACGATTT
TCAACGGTAAGCTTCAAAAATTGTGTGTATTCTTGAATACCCACGAAATA
CAAGGATCCATTTTGTTTTTGATAAATCTTGGAAATTATAACCAATGAAA
AAATTCAATAACTTTTCATGTGTCAGAAAAAAGTCGATATTCAATAATTA
AGGTATTCCATTCGCATGAGCGTATTTATTGGTGGCAAATTGGGGCACTC
GAAATTTCGACTGATTCCGAACCTCTGAGAAGTCGTGGTTACATAGGAAA
AGCTTCTGCTTCTGCCATTTTTCCAACTTCTATCGTCAATGTCTCTCTTA
AACATTCGGTGGCCCTTTAGTTTTATCGTTGCTGTGGTTTCCTTAAATTT
TCTTCTATCTGTGAGACAGTTCGTATCAGGAATTAAGAATTATTTACTAT
ATGAATTATTGAATAGAAATTGGCAATGATGGAATCTTCGTAAGCTGCAG
TATAAATTTTACGACTTTTCAAGTTTTAATTCTTCATTAAATGTTCGATA
ATTGAAATTTCGCCAATCTATTCGCATGCACTTTTACTTTACCGTTATTT
AAAATGAGTTATTCGTAGAATATTCGGGTTCGCGAAAGCAATACCTTAAT
TTGTCGCTAAACTACATGGTAACTAGCGTCCAAATTTTTCAAGTGTATCC
AGTACTAATTCATTTTTGCGTACCAAAAATATCGCGTAATCTTGGACAGC
GAATGTTCACCCATCTACCTTAAATGCGTTGCCGAATGCGACTGTGCACC
ACGGTTGAGGGAGCAAAAAGGCCAACCAACGTTTTTGGCGCTCACAAACG
TCGAATTAAAATGGCCGAATCGTGGGCGAGTAAAATACATATCAGGCACG
CTTAAGAGTCTTAGCTTATTCTATCATATCGACTAATATTTATTGTAACT
TAACACTATTTAACGAATTATCTCATAGGAGGAAAGTAAAAGGTGAAAAA
AAAGCTGCGAAGGAAAGAGCCGACCAATGAAATTCGTTCGCCGGAGTGTG
GCGCACCGTAGAAACCGTTTTTACTGCACTCCTTAAAGAAATATTTAAAC
TCTGAAGAAACCGTAAGAATTTGATGATCTTTGTAGAACGGAACGAAAGA
CGCGGGAGAGGCTTTCAGCTCGTTTGGATAAACAGCAAAACTGCGTGATC
TTTTGTTACTGAGAGAAAGCCACTCGCTGCTCCGAGGATTGTAGAATCGT
CTCAGAACGGGTCGGAAAGTTCTCGGTGTCGAAATCCTTGATTATCTCCG
GGCTGAGACCTGCGCGGTTAACTTCATTTCCGACATTAATTTCAACGCTT
TGGAGCTCTCGTTCCACTGGAAACTCCCTCAACGTCAACTACCCACTAAA
TCGCAGAGCTTTTCTTAGCCTTTTTCTTCTCTACCGATAGCTTTTGCTCT
TCCGCGTACAATCAACGGGTCGAATTAACAGTCAGGCATGTCGAGCGAAT
TTTGCAGTAGCGAAGAATTCGGTTTGAAAATTCGCACGAAGATCGCCTCG
GTTGCTCAGCTCGAGTCAATTGTTACCAACGCGAGTGAGAAACGGGACAA
AAAGCTTGCTGAAAATGATTTTAAGGTAGTTCGTGCACGAAACGATTTTC
TTGAGAAAGTCTTGAAATTTACACAGAGTTTAAGTGGGCATCGACTGACG
CGCATGTCAAATTTTAAAGGACTCGTTTCATTGTTTATTTAAATAAACGT
CTTTATTAAATATGAAAAAAAATACACAGGAGTATAGGGACTGTGCTTAA
AAAATCGTTTATCTTTCTATATAACGAATGAACGCTTCTTACAAAATTTA
TGAAAAATCGCACACAATAACAATAAAGTATATTACGAAAGTCTGGGAAA
AACAGTCGAGACGATTGTCTTACTAGTAATGAAGACATATTACCTTAAAG
ATTGAACGAAATTGGTTAAACGTGCAATCGTAACTTCACATTTGCTTGTT
TGGGCATATTGTTTCTTCTTGGCTTAGCCCATTGCCGTCAAAAAGACAGA
AGTCTTTTTATTATCACTTTTTTCTTGATCCATTTCTTTTTGACATAAAA
AAAGAACAGTATTTTAGCGAGGGACGAATGGAATTGGGGTTCGGTCAGTG
TTGGATCCCCGTTTATAATTAACGGCTTGTAATTTCATTCGCCAAAAAAT
AAGTTGAAAAAACGTATTTACAATTTGGAATAAATGACTCCGACGTTGAT
TTAGAGTGATAATATCTTTAATTATTCGGAGACCCATAAAATACGATATT
TCGGGCATGATCTACCTTAACGGAGTTGAATTGAGGGAAGAGTATCGACA
CCCGTAGCCGTGGGACTGGGGCGTCCTGGGAGGAATGAGAATGTAAAATA
ACGATGAGAATATACGACGAAGATGAAAGTATTTAGAAATATATGCACGG
AGTCAAGTGTCTTTGAATAAATTTGTGCTTTTAACCGATGAAAGTATCTC
AACTTCATTATTTCATTCATCATTAAAGAGGAAAAGTAATGAATAAAAAG
TCGACTGTTTGACACAACAGTACTTGCGGGGCCTTGTAAACTCTTTTCGT
GCCAGTTCCAAAACTTTACAATCGCCACGAATTAATCACGATTTAATGCC
AATTTGAATTCGAACGAAACGTCAAGACTTGTGGTCCATCGACCGCTATT
ACGAAGCGTCGATGACCCGATGCGTTTCAACCGTGGAACAGCCTCGTTCC
TTCGCACTGCCCATGGGATCGAGGCACAGTTACTCTTTTCTAGTAGTGCA
TCACGCTCCCTCGAAAGTCTCGCTCCCGATAAGAAAGGAAGAATCGCGAA
GAAAGACCGAGAAATCGTCGTAGCATGAGAGAAAAATCCCGACGACGTAC
AATCCTCGTAAGAAAATACCTCGAGAGAGAGAGAGAGAGAGAGAGAGGAA
GATGAAGAAGAAGGAGAAAAAGTCGAGCGGTGCGAGAATTCCTGGTGCGA
GAGGTCCAATTTCACGCAACGATGGACCTCACGGTCTGGTTTGTTGCTCA
CAATTCTCTATTTTTTATTTCCTCCTTAGTTCACCCGTAGCCTTCTATTT
TGCCCCCAACCTCGTTCACCACGCTCGCGATACCGCGTCGAGATTCTTCC
CCATTTTTCCTCGCTCTCGTTTACAAATCACATTTCGTTTTTCACAAAAT
GTCCTCACCACGAAAGCACCGAACGCACTGTCCCGCGTTGACAGCTGTTT
TTTCATTCACCAAACCGGAGAAGTTAGGGATCGAGGAATAAAACGGACGA
TTATTATATATTCGATCGACGGAAGTTACGCAAGGCCGACGAAAATTCAA
TAAAAACAAAGCATTCACTAAAATAGAGAGTCCAAAACGAAGTTGATTAT
TACGCGAAGATAACGATCGTTTTCTATCTTTAAAATTAAGAGACAGAGAA
TCATGAGGAATGTGAGAAACAGAGAGGCTGAAAGTTGTTGTGAATTTCGT
GCGTACACGTTAAATTAATGCGAACAAACTAAAATCTACATAAATCACGA
CGTATTGAATCATTCTTTTTGTTATTACCATTTGTTTTTATCTCTCGAAA
TAATAACCAATTGCGATGTTTTAGATATAAATAAGGCTACGTTTTAACTG
TATCTTACTTACTAAGAACATTCAGGGTGGGGAAGGAATAAACAAATGCG
ATTAAACACACCGTAAATCGTAAGAAACACGTTAACACGAGAACGAAATC
GATTTATCGATGACGAATAAAAATAGGTTGGATTTAAAGTGCTTTACAAG
TGAAACTAATTCATATCAGTAGATAGTAAACGCTCTATACATGCATATAT
ATATATATATGTATATATGTACGTATATATATACATTATACATACGATAA
AATATCACAATTATTAAGATTATTATTAATAATATTACGGTTCATTATTA
CTACTATAATTATATTCGAATAACGTATTAGAGTGGTATTTCGTGTAAGT
TTTATTAGAATAACTATGTATACACCGTAGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGAGAGGG
back to top