BAP2ALocus_1022_Transcript_3/12_Confidence_0.425_Length_7162 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1022_Transcript_3/12_Confidence_0.425_Length_7162
Unique NameBAP2ALocus_1022_Transcript_3/12_Confidence_0.425_Length_7162
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length7162
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1022_Transcript_3/12_Confidence_0.425_Length_7162 ID=BAP2ALocus_1022_Transcript_3/12_Confidence_0.425_Length_7162|Name=BAP2ALocus_1022_Transcript_3/12_Confidence_0.425_Length_7162|organism=Venturia canescens|type=mRNA|length=7162bp
TTTTTTTTAAATGACAATATATTAATTTATTGAAAATAAAACCAATATCT
ATACAATTCTCCAAAGCTTAAATAATTATAAAGGTGTTTTCATTATATAA
GTAACGATGAAGTAGATAATCGTTGTCCAAATTTATCTCAACGAAACTTC
TTTAAAGTTCTTATCGCAAATTTGTCGAGTTCTATAACTTGAATAATGGA
CGAAAGATCAACAACGGAAATGGGATGAAAAATATGAAATAATCTCAACA
GTCCTTATTGTTAAAATTCTCCTATACCTTTTCGTATATGGGGTATATTT
TCCTAAGGGAATTTCATGTAAAAAGTCCTAGCCTACTATGCAAAAATTCC
TTTACTCGAAATGCTCACCTTTTTGAATTTATTACCTACATTGTAGAGTT
ACCCGCGATTTTGTAACGTTGCGAAAATCAATTTCAAATTGTTTGGAATA
TCTAGCTACGGCCGAATACAAAATATTTTACATACGATCCTTTTCTATAC
GAAAGAAAATCAATCACGCGTCGGTGAATGGAGGTCTTTTTGAGGTTTTT
TCTATTATATGTATGTATATTCGCTCGTGTGACAGCAGGGAATCGTCTTA
TCGCAACACTACACTTTTTATTCCACTTCAATTACTTTTCCAGAATGTGC
AGTGAGCATTTTCAACGCAAGTTTAAGAGCGTTCGATTTATCTGTTCGTT
ATATTTACACCACAGATAACTTATCGTTTAATTAGGCGCTTTTAAGGCGG
TTCAAAAAAATTTTGATTAAAGAAGAAAAAACTGTGCCCTCACGATTTCT
TGAAATTTACGTTATTTTAAAACGGCAGAAAAAATTAATAATTTTTCGAC
ATAAAATGCAGCATATTGAAGAGGAATTTTTTTCCTGTTTATACAAGCAA
AACCGTTGCTTAATATTATCAAAGTAGCCAACTGATAAAAATTTCGAATG
CAAACTTTGAAATAACAGCCTCAATTGGTTAAATTGATTTCATGAATATT
TCTTAATTAGTTTCTTGAGAAAAGATTACTGTGATTCGACTCTTAAGTCA
ATGTATTCTGATCGAATACGGAAACAAGTGTACTCTCATGTTATTTTAGG
GAAAATATTGCCAATTGCGCTGAAAAAGTATTAGTAAAATCGAAGCTCTT
TGATGAGAATTCGACATTCTTTAAATAACTAATTAACAAATCTCGTGGTT
GACTTTCCAATAGTATTTGATTATAGAATTCCTGTTTCTCAGTTTTAACT
TTATATTAAACTAACTTTGAACCTAAATAAAACCGTTCATTTTTTGGAGA
AACATTTTTTAAAATATTAATATACGTAGTTTGTAGGTTTTATACATATA
CAAGAGCTGATCAGGAGCAGTTGAAGCAGAAATCAAAGAAATTTTTGTTG
CTCTTTGAAATTGTTGTTCTTTGAAATATTTTTAGTCTTCTAATTTTGGA
ACAACTTGAAGATTTTCACTACATTTGGAAATGTGTAATCGATGGAAGTT
TTATTGATTAACAAACTTTTAATTCGTTGTTTGTTTTTTTCGAAAGATGA
AAGTATTTAGAAATTTTAGCGACAGGAAAATTGTTGAAGATGAATTCACA
TTTGTACTTTCAAACTTCGAAAATATTAATAATATAGAGGACATAATCTC
GAATCATACGACAGAATTGATCAATCAGCGTTTTTAACTCTTAAGGAAAT
TCAATGACGTGTCGTCAAGTCATACTTAATCTTAACGCGAGACTTAATCA
TACGTAAGAGTCAACATTTGCCTTTTTTTCATTTTTCGTTCCTTATAGTC
TATTTTTCGATTCATCTATCTATAAACCATGTTGATGAACGAACAAAAAG
TTCAGAGAGAGAAATACCATTCCAAGGTATTTCGAGGCGTCTCAACAATC
GAGTCAATGATTTTTTTTTTTTTTTCGGGTAAAGAATAATTCTGAACAGG
AAAGAATTCTATTCTAACTCAACGTTGCTGGACAAAAATAGAGATAAACA
TAGATTTTTCTTATTTTTGAGCCACGAGTCCGCCGTTGATTGAACTAAAT
ATTTTTGAATCTATTACTTTGGAATAATGAAAAACAAAGATTCCATCTTT
AATATACGAAGGGCGAGAATGTGGATAAATTTCTCGAGTATAGTGACGAA
TCACGCAATTAAAAATTATCCTCTCGAAGTTTTTTGCCTGCGGGTGTTTT
CGTTTATTTTCTGTTTCCCGAAGGATAATATTATGAGAATCTTGAGGAAA
CGCAATCGTAGAGACGATTCCTAAAGTCGTGAGATCATTTTCCCGGACAA
CTTCTCGAACACGCCCTCAGCTGGTTTCCTTGTTTTTGGGAATCGCTGTC
CTCGTCGCTGCAATCTTCGTCGTGCGTGTGCGTCACATTGCGCGGAGTTT
CTGGACGAGCGTGTGGAATTTGATTGTTCGCAGTGGCACTCTCTATTTCC
AATGGTCTCTGAGCGATAAGTCGATTCTGTTCTTCCTCCTCGTCAGTGAG
CTTGAAGGTCCGTGTTCTACTGATCATCGGTGTTTCCATAACGAACCTTT
GTTCATGAGCTACTGTGCTTTCATGAGGCATCAGCATGGCCGGAGCTCGG
AACATGTAGGAGAATGGATAGTAGATGAGATTGAGGAAAGTTGCAGCGTA
CAAATCAGCATACCTAACAACTTGACTACTGAAAAAAGTTTGTCGGCTTC
CGCTTCGAAAGAGGGATCCCATCATACCGTATGCAAGATCCATTTTGTGA
GTGACGTCCCTTATAGACGCCCTTAATTTCGATATATCAGGTTTTTCTTT
GGTGCTGCTGTCAAGATTTTTGTACATCTCTCCGAGCATTACGTCGAGGC
TTTGAAGTTCAGCAAAAAGTTGACATTTGTCTGTCCAAACGTGTAATTCT
TGTACGAGTTCCGGCACTATCAGGAACGTTCTCCAGCCTCGAATTTTTTT
GCTTTTCAGGATATCACCGAAAATATGATCTCCTATGTAAAGCACGTCTT
TGCCTTTTGCCCCAATCATCTCGGTGAAAACGTCGCACGATCCTCCCGAG
TAAACTTCACCCGTATGAAGGGGTCCTTTGTGCGTACCAAGTTTCAAAGC
ACCAGTTTTCGTATTGACTTGTCTCAATATCGTGCCTTCACCGAAAAACA
GAGGTTTCGTAGCGTCAACGACAATGACGTCGAAATAAGTTTTCCAGTTT
CTGTGAGGTTCATCGGGCCTAGCTCCGTGAGGAAAATCGAATAAGTACGT
CATTATTTTATCGGTGAATACGTAATCGCTGTTCGTGAGTAAAAAAACTT
TAGCTCCGCTCTCACGTATCCTGGTAAGGAACATGGGCAGCCTGTCGTCC
TTCTTAACGTATTCGTCGATTTTCTCGACGGTTTTACTCTTGAGATCGCC
CTGTATGTGAATCCAGTCGACGGCGTTTCTCACATCTTGGAATATACTCT
TGAAGCTCATCGTCAATTCACCCTCTTTAACTCCAGTCTTTTCGCGCGTG
TATTGCGGCGAATTCGTGAAGAAATCAATCAGGCACGCGAGCAAATAAGT
TTCCGGCAAATTGAATAGTGTATTGAGCACGTACACACGGGATTCGTCCA
GCTGGAGAAACTTGTTCGGATAGAGCTCATATACCTGCGAATGCTTCAAG
AAATCGAAACCGTGAACACACACGAGTATATTTCCGTAGGCATCGACTTT
TAAAAGGTTCCCGTAGAGCGTGTCAAACCATAATCCTCTCACTGGAAAAC
TGGGATCGTATTCGAAAGCCTGAATTTCTCGTGGATAACCCAGAGAGACT
AAACGGTCCTTCAAGAGATTGAAACCGAGCTGCTCGTACTGCGGTGATTT
GTACTCTGCCAAAGTGTAGTCCATATCGAAGCCATAGAACTTGATATTCT
CCAGATGGAGACTTCTGTTGACAAATATTGCATTGTGTGCACAACTATGA
TGATTAAAGGGACTGCCGAAATCTCCAGCTGATAATCCGTCATCACTCAT
GTTTTTCAGCCACATAATATTTTACTTGAACAGTAACGCGTATTTTAATC
CAGAACACAATTTTCTTTACAACAAAAATGTCTTTGGTACAGAGACAAAA
AAGGAATATCGTGTCCAATGTTTTTCAAGCACTCGCACTGCAGAAAACGT
GTAAGAACGTTTGTAAGAAGCACGTTTACAGGACACGCACATGCACCAAT
GTTTTTCTTCTGATTCTTAATCACCGTTCGTGACGATAAATCGATTTTAA
ATACTAATATTAGACATTATTTTTTTTCAGCCACAACATTTAGAACGTTT
GCTAGATCGAAAGAGAAATAATATCGATTGAAAAGTCTTTGTTCGGTAAA
TCAGCTCGCGGCACGCTTGCGAGATAAGAAAACAACGATGTTTTTTTAAT
CGATACTGCTTTTCTCGCGTTTTCACGTCATCGATTCGTCAATGATTCAC
CATTACGTAAAAGCTTCGACTCACGATATCCATCGACAGAATAAACTTCA
CGCTTTTTTCTAATTAAAATCAAAACTTTTCGTTAAAATATTTCCTCAAA
AATTTCCCACTTCGATATTTTAATCCCGAAATAAACCTTCGACGATCGAT
GAGATTTGAAAATGGCGTGATTGCGCGATACGCAGAAAGGTTGTCTTCCA
AGAAGCTTTTCTCTTTAATCGTGGATAACGCGATGTCTTATCAGCGCAAC
ACCTGAATTGTGTGACGAACGTGTGACGCACGAAAAATGTCATTCGAACA
AAGTGTCTGAGAAACAATCTCCTGTGCACACAAAGAGGCGATTGATGTTT
CGCGACCTTGCGTTAAGTGCTTCCTCCGCATGCCACCGACTCTCTCTTTC
CCTCTGCACGAAAGCTTCGTCTACAGTTTCGTGGCTTTTCTTTCTGCACA
GAAGAGGAAGCTGCCTGCGATCGGATACTAAAAGTGCAGTTTTTTAAAAA
AGTCGTCGCACAGTTTATGCACCGAATGACTTTTCAAGGGCACGTTCAAC
AGAAATAATTATTCGTCACGAACACGAAGCAATTTCCACTTCAATCTCCC
ATCATGGCATAATTATACGATATGAAAAAAATCAAATAAGAAAACAAAAG
TAGAGAACTTCTCAGCTCTTCGAAACAGAGATTTTCAGCGAGATTTCCGA
GCAACTCTCCTGCACAATGCACCTACACGTGACCCTCAAGGATTGTTGAA
ATTTCTAGAGCACCGAGTGTCTTCTATACAGTAAGACTGGGCGATAGAAA
GAATGGCAGTCCCTGTGGGATGTTCGGTTATTGTCGTGGTCACGTATTAG
TGTCGTATCGTAGAAAACTATATGCAAGTGCGATGTACGAGGTATTTCGA
TGTGACGAGGTGAATTTTTAACTGACTGAATTATTTCATGCCTCCGGACT
ACTAGAACATTGACCTCGTTGCGAGGGAGACTTCTCGAGACTTGCCACCC
ATCGAATTACCATAATCCAAGAGAAAAACAGCTCCCGAATATTTGAAACT
GTTGCAAAGTACGTGCTCACCACTATTTTCGACTGAAAACATCCGAACGA
GCAACGATTTCACGGTGTTCATTGAGAAACGTTACAAACAACGATAATGA
TTTTCAATTTGAAAAATAGCGTTGAGAATTCTCTACAATTTTTTTTTATA
AATTCGTCAACGATTCAAAGCTCGCGATACACTTTTGAAGATGCAATTTT
TCGGTAGTCGCTTCCCTCATTTTCTCAACATTTTTTATGATTTTAATGCC
AAGAGTACGGTTACACTTGTATTTAAAAAAAAACTAAATCGATGGAATAA
TTAACGAGTGTCAAGAAACCAATTGGAGGTGAAATAAACATTGATAAAAA
AGGATTTTCGATTCGAATGAAGTCGACGTTAATTGATCGATATACGAAGT
AACGAAAATTGAAAAGTTTCAGTCCACACAGAACTGCCCGTATTTTGCAT
GGATTATCGCGAGCTTGTATACATGTTGTGGAGAGGAATGGAGCCCACGT
TACCGGGTCGATGGGTCGTGACGTGAAAGCGAGTACGCAGTCCTAAGTAA
GTGAATGAAACTGTTTCGTTCAACTGCATGTGGGATGGCGTGTTACGAAC
AATTCAGCCTCTTAATAAACAGAGCCCTTCAAAGTGATATCACACTCGAG
CACAATATCCTTTTCAGTGCATTAGAATCACTATTTAGTGTAAAATAAAG
TTGAAAATTTCGGTGAATGGGTTCTTTTAAATTGTGACTTTTTGGTATAG
AAGCAACACTGCAAATTTCTCTGCACATTGAAATCGTACGACGCTGAAGT
TTGTAACGTTGGAGTCCAACGAAATGAACGAAAAAAAAAACCTTTGAAAT
CGATCAATTTTTTATTTCACCAAGTATCGATGCAGCTTGAAAAGCTACGA
CGAATTGCAAATTCGAAATTGAAGATTTACTGGAGTTACAGGGTTTTTTA
GATCAGTTGCAACTTCAGCGTCATCGAAATCGTCAAAACAATCCTCGTCG
GTTCGGATAAGAAAACGCCGGAAAAAACTTGGTCCCTGGGAGATTTCCGG
ATCTCAATAAATTCGAATCTGACGCTTCGCAACGATTCGTTTATTTATAT
TTGCCTCAACTGCACGGAACGCCTGCTCGGGTGACACTCCGGCATAACGA
AATAATTAGGAGCCCCTAATTAGGAAAATCGAGCTCGTCGTTTAGCGAAA
CTTCAGTACTCGTGGGCCGAATGACGATTACTGCAAAGTTGAAACTTTCT
GTGATTCGAGTTTCGCGTTAAAGAGTACCTACAAACCAAATAATTGCCAC
AATTTCACTACGCTATTAAAAGTCATTAAAAAAAAAGGATGATTAAACTC
GTCGCGAGAATGTGACCGGTCCACAAAACGCTTAATAAAAGTCACTTGAT
TATGATTCGCTATTGACTCATCTCACTGAATATTTCACCAATTCTGTGCT
AAGCCGCAGTTCCGGAAAATCCTAAACGCGGAAGAAAGTTTCGCGTCGTA
TTTTCAAACTTCCAATTGCCCGATAAACATTTATTTTGTTTATGAAATAT
TTTATCCCGAAAAAATCGTTCGCGTTCCCTCCCCTTTCGGTGCTATTATT
TTGTTTATTGCTATATTTTATCCCGAAAAAATCGTTCGCGTTCCCTCCCC
TTTCGGTGCTAT
back to top