BAP2ALocus_104_Transcript_5/5_Confidence_0.750_Length_4785 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_104_Transcript_5/5_Confidence_0.750_Length_4785
Unique NameBAP2ALocus_104_Transcript_5/5_Confidence_0.750_Length_4785
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length4785
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_104_Transcript_5/5_Confidence_0.750_Length_4785 ID=BAP2ALocus_104_Transcript_5/5_Confidence_0.750_Length_4785|Name=BAP2ALocus_104_Transcript_5/5_Confidence_0.750_Length_4785|organism=Venturia canescens|type=mRNA|length=4785bp
TTTTTATATATAATGATGTATTCATAATTAATATTCTTGAAAAAAAAGTA
GTATGTATAATGTGTTTTTTTTTTTTTTCTCCTACGTTATGCATTCGTAC
GGGAAGTGCGGAGACAAATATGGCCCTGTTTGGCTAAAGAGTCGTCTAAA
CAAGCATTTTGTGGGCTTTCCAGACCACCTTTCGTCATACAGCGACCTTT
CTCTTTTTCCTCTCGCTTTCACATGTTTTTCTCATCCACTCATCTTTTCC
TCCCTCGCGCGCTTCCTCAATTCTCTTACGTAGTGTTATTTCTATATTTG
AATTCTGTTCACACCTTGTCTCTGCCACTTGGTTATTCCATCTTTTGTCT
TTACATTAAATTATAAATTTTTTTGTTAAAAAAAACAATGTTTCTTTCTT
CATTCAATGTTACCGTATATGGTATGTGATGCATTTGTAATTCAATACTC
GATCGAATGTGTCTCTCGCTCCCCCGTCCCAATCTCTCCTGATTATATCG
GGTGAAATGACTTTGCTCCCTGTTTCACTTCTTTCTTCACCGGCCTCGAA
TACTTCTCGGCTAACATTTTTTATACTTCTTGAGCTTTGCTCCTCTTCCA
AACGGATTTATCACACATCGAGGGATTCGATGAATTTTCAACGATCTCTG
TAGTCTTATTGTTGTGTTTTCTAAACTTTGCTCTTTTTCTCACGAGAATA
TCTAACGATAGTTCGTCGACGCCGACAAAATTCACATCCATAAACAATAA
TCGACCGAAACACAATTGTGAACAGCAAGTTTGCATACATAATTGGACTC
GTATTTTTTTTTCGTTCCTCGATTTTTTCTAAAGAAAAAAAAAACAAAAT
TCTGATTTTCATTTGCCGTTGTCCATTTTCAATGTTTTTTTTTTTTTTTT
TTTTCATTCCCTAGTCGTATTCCTACTGTTCATTTATTTTTATATTTATT
TGCGAACGCGTTAAACGATGCCTTCGGAGATTACTGAATTCCAGGATAAT
ATTTCGTCTGTACGGGTCCCGAATGCGGACACGCGTGCTCACGCATGCAT
AGATTCCTCAACTATTATCAATAGAGAAAAAAAAGAAAAATAATACGAGA
TTTAGTAGAGAAAAAAAACTAAATCGATATGTGTTACTCTAACGCGAAAC
TTTGTAACATTTCGTTATTCTCTTGCTTTCGGACTCTATTCTCTTTCCGC
TCGTTTACATTTTTATTCAATTTTTATCATGTTGCTTCATTTTTTTTATC
AAGAATTGAACAAAGAAATTATTATTGAATACTCGCTCGCCATCTCGATT
CCTCGTGTACCTTGAAAACATGTACGCCGCATTACTTTTCTACTTATCAA
ATGGGCTGCCACTTCAAAGAAGACGAAATACGGGTTACCACCAATGGGCA
TGCCAATCAACATATTATTGTAATAATTATACTCGCATTATACGATTACC
GGTTAATAAAACTCGTTTCTTTTCACTTTTCCAAACACACGACACGCACA
CATACCGAAACACACACACACACACACGCGCGCGCAAATATTTCAATCAC
GCACGTTTCGAAGAGCGTGTAATCGTTCATTTGTATCGATGGTCAGCTTG
TAGATTCGTGTTTTCAATAAACTTTCCGCACTTTTACAATGGTGATTGCG
TTCTGGTTGACCAATCGGGTTTACACGACAAATTGCCAATCAGTGCAGAA
AAGTGTATGCAGCTTTGAAGTTTTCGACGTTGAAGTTTTCGACAATGGAA
AATTTTCTATTCTCCATTTCCACTAATTTTCTTGAATTCCATTGCACTCC
AATGAGGAATACTCCAAAGTCTCAGCGATTTAGATGAGGGCGCAATCGCG
GCTTGTTAAATAACAATAAAGTGTTACTTAACAAACTGCTTGTAAGGTCT
AAAGCCGTCATGAAAGTGCTCTGCTTCGATATCTCACATATAACGATGGA
TTAATTTTCTGCCTGTTTTTGTAATCATACATCAATCGTTTGATCAAACA
ATCGCGGTGTACTCAATCTGCGGATGGTGCACTAGTCGAGAAATTATTCC
ACCGCAAAAAAGCGGTGGCTGTGGGAACATTGTCAATCGTACAAATAATA
AAAATCAACACTTAGGAACCATAATCCATACAAATTTACCGATGACGAAT
AACGATGATTTCAATCTCAGTCGAAGCTTCATTTTTTGTACGTTTTATTA
GTTTTTATCAGTTTTTTTTAATATTTGGAGTCTTGAATTCGCGCAGTACT
AGGTACTCAAGGAATCAGACGGTTAAAAATAGATTTCCGCTCAGTTGAGA
GCGCAATGAATTCCATAAAGGTTACAATAAGTGCCCTCAGCCACTATCGC
CATACGAAATATATTAAGAGAAAAAAAAACGCAAATCGCTCATCTTTCGT
TTAGTCACGTGTCAAGAGTGGGACGAAATTATTATTTCGAAAGTCGCAGG
AGTCACAGAAGACGTTTGGTGGATGCTGCGTCGTGTAACATTAGCTAATT
TGTTGTTTTAGATGTTATTTTGACGAAAGGAAGTTCGAGAGATTTGGTTA
AGTTTTGACAATTCGTTATTATTTTTTCCAACAATCACGAGGGATTCCAA
TTTCATCAAAGGGTTGATCATTTTTGCACGCTTTGTACAGCAGTCTATCT
CTCTCTCTCTCTTTCTTTCTCTTGATCGGCAAATCATTTCACACCAGCTA
ACATGAAAGTTACAAAATACTCCAAAGGATTTTCACAACTGTACATATTG
TAAAGCATAAAGAAAAACAACAAACTTTGACGTAGCACATTTGCGGACGT
TTGACCAAAAAATGATTATTATTACTGACGTATACGCATCGAGCAAAAAA
AGAAAGATAAAGAAAAAACGAAAAACACTGAGTGCAGGCAGAGCCCATAT
ATTATGTTCGATTCTTCCTCGACGTATGATTCAAAATTTGCATCGTATCT
TCTCGTTATTGAATCTTGAAAATAATATGGAAAAACTTCGTTTTTCTCCC
GATCGCCGTCGTCTCTTCGCATAATTTTGTTTTTGAAAACATTTCGACGA
ACAAAAAATCGTTCGTACGTGTACGTGTCCGTATGTATGGGAAGAAAAAA
CCACGCTGCGAGTATTATTCAAAGGAAGATTGATTTAATGATTTTCTTTT
ATTTTTTTTATTTTTTTTTTTTTTTACAAAATCACTATGAAAATTTGACA
TACTGCCTTCGGCTGAGCGGGACGAGAGAATTTTTGCGAGTGAAAGATAA
ATTGACAGAAGACGTGACCATGTGGTCGAGAATTATAAATGGCGAGAAAA
AAAAAACATTTTTTTCGTCCCTAATACACGGCAATATCAATTTTTGTTGG
AAGCGACGAAAAACTTCTGTCCACCATACAGAAAATATGAGGAACGAAAA
GAAGGAAATACCACAAATTTTGTGGGAAGAGGTGAGGTCACAGGAGGTAC
ACGGACGGATTCGCAGTGACGAATACCAATGCAAACCCTCCGTCAAAAGT
CAGCCCGACTGTTCAGAGTCGAGAAAAAAACGGAACCGAAAAACCATTGG
AACAGAAAGAAGAAATAAATCGACCTAACATCGTAATCTAGACCGAATTG
TATTTATTCTTGTCGAGGTACGACAAATCTCTGTCAAAAGAAAAAAAAAA
ACTTATCAGCCAAGAACGCGTAGCACAAATTTCGATAGAACCGTGGAAAA
TAAAATGGAAAAAGATAATATAACAATAATAATATTAATAATAATAATAA
TAGTTCGAAATAGGTGTATCCTCGCTCTTAGTCCCAATTCACATTCTGGT
ACATAATCAACAATCTCTCGTCGTTTGATCTCACACGTTCGCAAAGTGAC
TTTCGTTCGGTCAACGTTCATTACTCTCTCTTTCTCTCTCTCTCTTACTC
TTTCTTTTTTCTTCTATCTTGCGCGGGAGTTCGCACGCGCGCACGTATCT
CGGAAGCAGCGGACAGATTTTGGAGCACACATTGGATAGTGCACACACGT
CAGTTTTAATAATCGGCCGGTCGTAGTCGTCGTTGTCGTCGGAGGTTGTT
TTCTTTCCCGTATCATTGGTAAATGCATACATACATGTATATATGTATAG
ATATAATCAAATACGTATACATGTATGTATGCGCATACGTGTTAATGTAT
ATCGTAATGATGTGTATAAACGCGTTAACCGAATTCTCCGAGCAAAGTTC
TCTCGTGTCGAGCTCTTCGGGGTGTTAGTGTATCTCATACGCGTGATATT
TATTATTCTATGCTTTCAAATTAATATCGTGTATGTACGTGTCTCTGCGT
ATTCCGTCTGCGATGTTTTTTTTGTTTCTTCTTGTTTAAGTTGTTGTTGT
TGTTGTTGTTGTGTCTTATTTATATTGTTGTTTGTAATAGTTGATAAATC
TTTAATAGTGTCCATGCGTGTCTAAGGATTTTGTTCGTGAACGGGAGAGG
GAGGAGATAAAGGGAGTAGGGAGTGGGGAGCAGTGTGGGAATTGGAGGTG
GTACGGCAGGGATATTTGTTTTCAGGTCGAAGGTTGGTGGTTGAAGTGAA
TGTTAGGGGCGGGGGGAGGGGGGTTCAAGGTCAACGGGGACTCGGAGCAG
GTGGGCTCGGCCGGGGGTCAGGCTCGCTCACTATGCTGTGTGGTAAACCC
GGCAATCCGCCAGTTGGTGGAGCCGAAGCGGGACCACCGGCCCCACCACC
GCCACCACCGCCGACCGTTGGTCCCGAAGGTCCGGTCGGTCCACCCGCAC
CACCGCCACCCGATGACGAGTTTGGACCACCTCCC
back to top