BAP2ALocus_1050_Transcript_4/4_Confidence_0.667_Length_2536 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1050_Transcript_4/4_Confidence_0.667_Length_2536
Unique NameBAP2ALocus_1050_Transcript_4/4_Confidence_0.667_Length_2536
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2536
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1050_Transcript_4/4_Confidence_0.667_Length_2536 ID=BAP2ALocus_1050_Transcript_4/4_Confidence_0.667_Length_2536|Name=BAP2ALocus_1050_Transcript_4/4_Confidence_0.667_Length_2536|organism=Venturia canescens|type=mRNA|length=2536bp
AGTCCGGCCACCATACGGGGTGATCCCCTTAAATACACGCAATATATCAT
TATTTCATTATACATCTGTTTCAAAAACTAGACTTTCAACTTTCCTCTGC
CGGTTTCAATTCCTTCCGTGTCCAATTGCATATAAGTCGATGGACTTCTC
TTTTCAACGGCGAGTTATATATCATATTTATAATAGACAAAATACAGGTA
TTTTTTCGTGATTGACATTAATTCGCAACTTTTTTTGGTCTTTTTGGTTC
TTTTTGGCTTTTTTTGGCTTTTATGGCCTTTCTGGATTTTTTTGACTTTT
TTCACAACTATACGATTTTTGTCCATGCAGTGAATAACGGAGTATCTTGT
TTTTTGGCTTTTTCGTATTTTTTGGCTTTTTTTTTGGCTTTTCTGGCCCT
TTTGGATTTTCTTGGCTTTTTTCACAACTATACGGTTTTAGTCCATTCAG
TGAATTTAGAGTCGCAGCAGCGACTCTGAGACAAGCACATTTATAGGATT
ATTATGTATGCTCTATATATTGAGCAGGTGCTTGCAGGGAATGAAAGTTG
GTATTCGTGTGTCCTTCATTATCATCGCTGTCCTCAAAGCATGATTTATT
GTTTTTATACTATGAATATCTCGCTCGATCGTCGTCAACGATTCGTTCGA
ACAAATAAATCGAAATAATATGAAAATGTGCTAATCTTAAGTGTTCAAAA
TGAATTTTTTTGTTTTGGCGACGCGCAATTGTGTAGGAAAATATTTGCGA
CAACAAGAAAAAAAGAAGAGAGCGTATATTAGTTGATACTTAAGAAATAA
GAAATGATACCATTCAGAGTATCTGTTTATGTCTGTTACAATGTATATGT
GATTGCTTTAAATAAATAAAATATATATATACATATATATATATAACAAT
GATATGGAAATGTGTAACTTTTTACTGCAGCTTTTCATTCAGAATGGGAA
TGTTGAACCTAGGAAATCGAGGAATCTGATGAATTACCACAAAACCTTCG
AGAGCAATATTTTCCAAATTTTCAATCACTTCATGAGTTGCTTCAGTTGG
CAATCGTAACATGAAGAAAAAATCGTTCTAACGTCCTGCTATTAAGCCGT
TCGTCACAATTACACAGACACACAAAACAAAAAAGTACTTTTACCAGACC
CATCAATTTCGTATCGTAGTTCGACGAAAAATCATGCATGACTAATGTCA
AAAATGCATTTTTTTTTGACATTTTTAGCAATTTTTCGCCAGTTACTCAG
AATTGAAAGGCGCTGAACTGTCCCCTAATCAGAATCAGCGCGTCAAAACA
CATGGAAATTGTTGAGTCTTGTCATAAGTACTGCGGCCACTTTTTTCTTT
TGTGTGCCGGTGTTGTTGAACATGTAAACATTTACTTGAGGTGATCCATC
ACTTTCAAAGTCTTACCAAAGCGCTTTGCTGTCAAATTTTATGGAAATTC
AAAATATTCATTCAATTACCAGCTTTTTTTTGAAAGATTTATTGCCCAGA
CTTCGAAATATTTTAAACAAGGCTTCTGCAGCTGTAAGAATTATGGAAAT
AAGTGATTTGAATTATCTCACGATAACTTTTGAGGACATTGCGATAAATA
TTGAAGGCGAATATTAAGCAGTAATTAGGCCGAGAAACTTTGTTTTTTCC
TGAAAAACTTTATCCGTTTTTTCATGAATCCATAAGTTTTTATCCTCTTC
AAACGTGACAAGTGTCATCGTTACAGTCAAAAGATATTTAATTGAGTTTT
TTAAGCATCTCAAGCTTTTTAACGTGACTGAAATGAGTGAATTTTTTTAA
AGAATAATATCTCATTCGATCTTGTTACTTGAACGAAAATACTTGTTTTT
AAATAGTAAGTGTTGTAAACAAAAGTTTTGCATTCCCGACTGCGTAACGA
GGAATGTCTTAGTCGCAGAAAACAAATGACAAAGTAAGAGGAAATAACTT
TAAAAAAATACGGATGATTTACTCCTTTTTTGGAGGTTCTTTGATAGTCA
CGTTTTCAACCTTTTGACGTGCTTCTTCCAAAACCTTTTTGAGTTCACCG
GTTCTTGTGGCATAATATCCCGAGGCATTGCGCGAAAGCACGAGTTGTCC
GTCGAGCCTCCGGCCTTCGGAGATACCGCATTGTCGTTCCAATTGTGATT
TGGTCAAAGTGAAAAGTTCGGCACCAGTCATGCCTCGGAATTTTTTGCAA
AGAATGTCGGAGAAGGCCTTGGACTTCAACCATTTTTGGACTTCTCGCGG
GGTCGAACGTTCGGTGACGTAAACTAAATGAGATTTGAAATCATCGGCGT
TTCGTTTCTTTCCGCGATATAGCATCATGACGGATTTCAGTTCCTCCTGC
ATTTTATCTTGCTGAATTGCCGTGTTAGATTTCTTGCTGTTTATCGTTCC
AAACGTGCTGGAACTGCCAGAAGCTTCCTCAGACTTGCTGGAACCGGCAC
AACCTTCTTTAGACTTGCTGGAACCGGCAGAACCTTCTTTAGACTTGCTG
NNNGATCCGGCAGAACCTTCTTTAGAATTGCTGCAA
back to top