BAP2ALocus_1051_Transcript_1/4_Confidence_0.375_Length_724 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1051_Transcript_1/4_Confidence_0.375_Length_724
Unique NameBAP2ALocus_1051_Transcript_1/4_Confidence_0.375_Length_724
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length724
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1051_Transcript_1/4_Confidence_0.375_Length_724 ID=BAP2ALocus_1051_Transcript_1/4_Confidence_0.375_Length_724|Name=BAP2ALocus_1051_Transcript_1/4_Confidence_0.375_Length_724|organism=Venturia canescens|type=mRNA|length=724bp
GAATATTAAGGTTTTCATTAGATCTACGTTACGTTCAAAGTGGCTTTCAG
CACCGTAATCTGATTTCAGAAAAAACTCAATTTTCCGACTAAAAGAGTTC
ATCCTAAAAATCTGCTTAAAGAATAAACCGTCCTGAAAGCCACTTTGAAC
GTAACGTAGATCTAATGAAAACCTTAATATTCAATGAAGGAGCTAATTAT
AGTTGATTTATCCAAGCGGAAGTACTAGTTTGAATAGTCAATTGATTCGG
AACATGTTCTGAGCATTTCTTATTTAATAAACTTCGATAGAAATGAATTA
TAGCTTTATCACCATCTTAATATATTTATATAATGGAAAAGTACGATTTT
TACTCTTATCTTCATCTATTTGTATTGAGATAAAAACGTATTCCATAGTG
TTATTTATTTTTTCGATGCTGATAACTTTGTGTGAGTACTGACGCAATAA
AATTCTTGCTGCAACAATAAAAACAGTATTTAACTATCAAAATATATTGA
ATGCACAGAATTTTTGTGTTTGTGCCAAAAGTTTCAAACATCGCCTTAAA
AATAGATTTATGAGACTGTTAAACGTTCAGGATGGACAGGATGCAAATTG
ATCACGTATTTCGGACTAGGTACAAATAAAGGAAACGTTAATAATGAATG
CATTAAGTTATGAAATTATTTGTCGAAAGCAAAGATGCAAGATTTCGAAA
TTATGTAATGAAACTCGTATTTTC
back to top