BAP2ALocus_1051_Transcript_2/4_Confidence_0.625_Length_1723 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1051_Transcript_2/4_Confidence_0.625_Length_1723
Unique NameBAP2ALocus_1051_Transcript_2/4_Confidence_0.625_Length_1723
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length1723
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1051_Transcript_2/4_Confidence_0.625_Length_1723 ID=BAP2ALocus_1051_Transcript_2/4_Confidence_0.625_Length_1723|Name=BAP2ALocus_1051_Transcript_2/4_Confidence_0.625_Length_1723|organism=Venturia canescens|type=mRNA|length=1723bp
AAATCCGTTGATTATTCTCTTTTTGATACAAAATGGATACCGTGCAGTAC
GAAATTTGTGGTTATGGGCTCGAAACCTCGAGGTACCGGAGTCATTCAAG
TTTACGAGATTTCAAATGGCGAACTTAAACTTGTTAAGGACATTCCACGC
TCGAATCCTATTAAGTGCGGCACATTCAAGTCTTCCAGTCTCCGGAATCG
GCACTTGGCAACTGGTGATTTCAAGGGAAAATTGAATATTTACAATTTGG
AAGATCCGTCAGTTCCTGTTTATACAGCCAATGCGCACAATGAAATAATC
AATGGGATAGATGGTGTTGCAGGCGAAAGCGTTGGTTGCGGTGCCCCAGA
AATAGTCACCGGATCCAGAGATGGAAGTGTAAAAGTATGGGATCCTCGTG
AGAAAGGTCGACCCGTAGCGATCATGGAGCCAAAAGCTGGAGAGGCTCGA
CGTGACTGTTGGACCGTTGCATTTGGAAATTCCTACAACTCTGAAGAAAG
AATCGTTGCAGCAGGATATGACAATGGAGATGTCAAAATGTTTGACCTGC
GTGCGATGTCTCTGAGATGGGAAACAAATCTCAAAAATGGTGTCTGTTGT
TTAGAATTCGATAGGAAAGACATTGCAATGAACAAACTCATTGCCACAAC
TTTAGAATCCAAATTTTATGTCTTTGATTTGCGAACGCAACATCCCAAAA
AAGGATTCGCTTATTTGAACGAAAAGGCTCACAAATCAACAGTCTGGTTG
GTCCGGCATTTGCCCCAAAATCGGGACATATTCATGACTTGTGGAGGTGC
AGGTTCTCTGTGTCCTGATAAAAGAAGACTCGCAGATGCAGAAGGAATTT
TCCAGGGTGTTGTAGGGAATCTTAGCTTATTACAAAACAGCACACTATCG
TCTCAGCCGGTCAGCTCTTTGGATTGGAGTCCAGACAAACAGGGTTTAGC
CGTATGCACATCTTTCGACCAGTGCCTGCGTGTTATAATTGCCACAAAGC
TCAACACATATTGATTAGCATATAAATATAAGGAATATATGTATTTCAGC
ACCGTAATCTGATTTCAGAAAAAACTCAATTTTCCGACTAAAAGAGTTCA
TCCTAAAAATCTGCTTAAAGAATAAACCGTCCTGAAAGCCACTTTGAACG
TAACGTAGATCTAATGAAAACCTTAATATTCAATGAAGGAGCTAATTATA
GTTGATTTATCCAAGCGGAAGTACTAGTTTGAATAGTCAATTGATTCGGA
ACATGTTCTGAGCATTTCTTATTTAATAAACTTCGATAGAAATGAATTAT
AGCTTTATCACCATCTTAATATATTTATATAATGGAAAAGTACGATTTTT
ACTCTTATCTTCATCTATTTGTATTGAGATAAAAACGTATTCCATAGTGT
TATTTATTTTTTCGATGCTGATAACTTTGTGTGAGTACTGACGCAATAAA
ATTCTTGCTGCAACAATAAAAACAGTATTTAACTATCAAAATATATTGAA
TGCACAGAATTTTTGTGTTTGTGCCAAAAGTTTCAAACATCGCCTTAAAA
ATAGATTTATGAGACTGTTAAACGTTCAGGATGGACAGGATGCAAATTGA
TCACGTATTTCGGACTAGGTACAAATAAAGGAAACGTTAATAATGAATGC
ATTAAGTTATGAAATTATTTGTCGAAAGCAAAGATGCAAGATTTCGAAAT
TATGTAATGAAACTCGTATTTTC
back to top