BAP2ALocus_1051_Transcript_3/4_Confidence_0.250_Length_982 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1051_Transcript_3/4_Confidence_0.250_Length_982
Unique NameBAP2ALocus_1051_Transcript_3/4_Confidence_0.250_Length_982
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length982
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1051_Transcript_3/4_Confidence_0.250_Length_982 ID=BAP2ALocus_1051_Transcript_3/4_Confidence_0.250_Length_982|Name=BAP2ALocus_1051_Transcript_3/4_Confidence_0.250_Length_982|organism=Venturia canescens|type=mRNA|length=982bp
AAATCCGTTGATTATTCTCTTTTTGATACAAAATGGATACCGTGCAGTAC
GAAATTTGTGGTTATGGGCTCGAAACCTCGAGGTACCGGAGTCATTCAAG
TTTACGAGATTTCAAATGGCGAACTTAAACTTGTTAAGGACATTCCACGC
TCGAATCCTATTAAGTGCGGCACATTCAAGTCTTCCAGTCTCCGGAATCG
GCACTTGGCAACTGGTGATTTCAAGGGAAAATTGAATATTTACAATTTGG
AAGATCCGTCAGTTCCTGTTTATACAGCCAATGCGCACAATGAAATAATC
AATGGGATAGATGGTGTTGCAGGCGAAAGCGTTGGTTGCGGTGCCCCAGA
AATAGTCACCGGATCCAGAGATGGAAGTGTAAAAGTATGGGATCCTCGTG
AGAAAGGTCGACCCGTAGCGATCATGGAGCCAAAAGCTGGAGAGGCTCGA
CGTGACTGTTGGACCGTTGCATTTGGAAATTCCTACAACTCTGAAGAAAG
AATCGTTGCAGCAGGATATGACAATGGAGATGTCAAAATGTTTGACCTGC
GTGCGATGTCTCTGAGATGGGAAACAAATCTCAAAAATGGTGTCTGTTGT
TTAGAATTCGATAGGAAAGACATTGCAATGAACAAACTCATTGCCACAAC
TTTAGAATCCAAATTTTATGTCTTTGATTTGCGAACGCAACATCCCAAAA
AAGGATTCGCTTATTTGAACGAAAAGGCTCACAAATCAACAGTCTGGTTG
GTCCGGCATTTGCCCCAAAATCGGGACATATTCATGACTTGTGGAGGTGC
AGGTTCTCTGTGTCAAAAAGTTCTATAAAATTTGGCTGAAATTATCAAAC
TTTTCATAATCACGGCAAACAAAATTCGAAATCCGTCATTTTCTCGGCGC
AATTTTAACTCAAATGAGAACATTAATCACAACAAATAAATCCGGCTCCT
TTTGAATATGAACAATTCAAGTCATATTTTTT
back to top