BAP2ALocus_1052_Transcript_1/10_Confidence_0.276_Length_3474 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1052_Transcript_1/10_Confidence_0.276_Length_3474
Unique NameBAP2ALocus_1052_Transcript_1/10_Confidence_0.276_Length_3474
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length3474
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1052_Transcript_1/10_Confidence_0.276_Length_3474 ID=BAP2ALocus_1052_Transcript_1/10_Confidence_0.276_Length_3474|Name=BAP2ALocus_1052_Transcript_1/10_Confidence_0.276_Length_3474|organism=Venturia canescens|type=mRNA|length=3474bp
TCATTATTAATTCTTTTACGGGGACGGTGCGCTCTCTCTCTCTCTCTCTC
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTTGGCTCTTTCGAGAAATC
TTTCAAATCAGCTCGCACAATGCTTGTGCAATTATCCACCTCCCTCATCA
TATTCACCCCGCATATATATCTCCTCAAAACAACCCTCGAATGCCTCCGA
AGTACAATACACCATGCTAATTTTCATGTAGCTTTTCGTTTTAACCTCTC
GCAGCGATTCCCACATTGTTTTATGTGTGGTTTTCCATACAAATTTCGAG
CAATGTTTAAAAGCATTGATACAATAATAACTCCAGTGTACTTGAACGAA
GTAACGCATTCTGTAAGCGTTGATAATAGAGAAAAAATGATTTTTTCGTT
TTGTTCGAAAAGTACCCGAAAAGTAAGTAGTCTTTTCTGGTTCTTAGGAG
AAATCGAATCAATAAAGGATCAACGATGAATAATTAATAATCGAGAGACG
AAGAAACCGGAACGATACCACGCCGCGTAACTCGGAAAAAAACGAGTAAC
GATTGAAAACACACAATTCTGTTTTAAAACCAAATGGCCGCTCGATTTTC
AGCGTTATACGCGTGTAAGCGACGAATACTTGAAATCTTTTAATCACCCG
CATTTCATTAGAGATAAAACCGTAGCTGATCCGTTAGATATGAATATAAT
CACTCATTCATAAATATGCATATGCACATCCGATCGAGTTGCATCCCTTT
GTACAATGTATGATATTTCGTTACATGTAATCAGTCGTGTGAGGGCCTTG
TATAAAAACGAAGAAAACCAATTTAAAAACAAAAAAGAAAATAAATAAGA
AAGAAAACAAATCGAAGAAAAGGAATTGTGGCAACTTTCTTTGTAATATA
TTGTATATAACAATTTATTGATGACATTGATAAATTCGTAGGTACCTTTT
CTCTGTGAATCCTTCGCGCGCGAACACAACATAAAACACACACATACACT
TGAACGGAAAATTTAAACGGTAAACTACGTGAATGCGGTACGCGTGGTCG
AGGAAGCACTCTTTAAGCGAAAAAAAAATTCATCGTCGGTATCATTCGTC
TGTATTATTTATTCATCGTACTTCAGTCAGGAATATCGCTGCAGGGGCGG
GGGGAGGGGGTGAGGACAATTTATCAAAAAGTACAGAAGGTATGGACTCT
GTAAAAGTCTAATAGAAATCGACAGCAATGCAAAATATCGGCGTTAACAT
CCAACAAGAGGATCCTCCTCGATCTTTGTATACACTTAAGTCGATTTCTA
TGTAACTTTTTAATCGAGTAACCTTAAAAAACATAGATGTCACACGGCAG
TCGGGACAAACACATTCCAGCCACCATCTCTCCCCCTTTCTATCTATCTC
TATCTCTATGCCTATCTCTCCCTCTCCCTCTTTCTCGGTCAACAGGACAT
TGATTAACAAGAATTATATAAATACGATATGAACATATAATGTAATAATA
TTTAAGGAATGACGATAGTTCCTTCATCCTTGTAAATCGCGCGTCATCTG
TAAATTAAAGACAAAGAAACGCATCATTTATCATAGTATACGAATGACAC
GAACGTGTCATTCGTCGACGAAGTTGCAAAAAAGAAGAAAAAAAAAGAAA
AAAGAAAGGAAGATTGAAAAAAAAAGGAATGGGCAGACAAAATATGGAAG
TGAAACGAACGCAAAATCTCTCTCACGTCGTACCGACTAAGATTATTGAA
CTATTGCTATACTATCATCTTTCATTATCGATTAATTGATTACAGCTTAT
TATTTTTTATTAGTATGAATATAATTGTTTGATTAACGACACCCTCTATC
GATTATTCATTGATCGCTAATACTAATTACTAGGCATATATATGTACATA
TTACATATATATGTATTATATATATACATATACATATACGAACGTAAAAA
AAAAAAGACCGCATATAAACACTTTATAAATACGAATATCAAACTCTTCT
AAACGGCGTCCTTCCACGATCCATACCGCTAACGATCCTTACCTTACTTA
GTGTTTAGTACGAAACGTTAGTGGTACTTAAAATATCTAATCGCTATCTC
TTTAATCTACTTAAGCTCCTTGGGAAATAAAAAGTAAGAAAAGTAAAACA
AAAGCAAAAGAAAGCATGCGATCAGAAAAGAATAAAGGAATAGCAAACCG
GAAATAACAACCATAAACCTTGGAACGATTTTTTGATTATAAATAGTGTA
AATTTTTTATATAGTGCGAAATATTATTGACCGTATGGAACTTGAAATAC
GTCAAGTGGTCATGTATAATACATGAATGAGGAATGAAAAAAAAAATAAA
AAATAAAACAAAACAAAACAAAAACAAAAAAGTAAAAGAAATTCTACATT
CAATACATAGTCTTTCGATCTTTTAAACAACAAAAGAAAAACAGAAGAGG
AAACAAAAACAAAAGAACAGCAATGAAAATAATTCTTTCGTTATTTTACG
CCTGATTTTACGAGATGGAAGGCACAACGGAGCCTGTTGGAAAAATAAAA
ACACTCGAGTGGGTGGAGCTAATAAGAAATATTTGTAGAGGTCGGAAATC
GTATTTTATTCGTATATACTCGATAGCGTAAAAGCGTGCCCGAAAAAAAA
AACGTAATCGGAAAAAAACCGAGAAAAAGATGATGACGATAAATTGAAAA
AAAAAAACCAGCACATTGTCACCCGTTTCTATTCGAGACTCGAAGTGCAC
ATGAGTTTTAAAGAAAGAATAAAAAAACGAGAGGGCCAGCAGGGGAACAG
AGCGAAGCATGCCTCGAGTATATTTCTTGTAAGCGCTTTTAGCACCCACG
AGTACAAACAAAACTGCTTTTCAAGCTGTCTTGGTTGAGTGTGCAAATCA
TTATTTTTCGAAGTATTGATCGGACGCGGTGTAAGCATGATGAGATATTT
CATTGAAGAGATATTAAGTTGACCTACGATAAGTCGGACGATTTTTTCAA
CGGTGTAACAGCGATGAGTAATCCACATAAAAAGAACGACAACAGCGCGA
ATATCGACTCGTCGAGAAACGTGCATATTTTCAATCAAAATATAAAAAAA
CTTCTTGCAATCACCGCGCACCGATCAAAACTTCGAAAACTCTGATGTGG
GTGAGAACATCCAAAAAATCGCGCGTAACCCTATAAATATTGATTATATA
TATATGAATATATTATATATATAAATATATATATACATATATGCATATAA
ATATATATAACTGTATATGTATACCTTAAAAAAAAAGCATAAACCCATCG
GTTGATGATATACATGTAATAAGTACTATTTAAATATTGTAACAATTGTA
TATGATTTTACTACTACTACACGCTAATTGTATTATATATATGAAAGATC
TGCGACCTCCCACTTGTAGAACACACACACACACACACACACACCCACAC
ATACACAGATACACACGCACACGC
back to top