BAP2ALocus_1052_Transcript_5/10_Confidence_0.026_Length_393 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1052_Transcript_5/10_Confidence_0.026_Length_393
Unique NameBAP2ALocus_1052_Transcript_5/10_Confidence_0.026_Length_393
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length393
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1052_Transcript_5/10_Confidence_0.026_Length_393 ID=BAP2ALocus_1052_Transcript_5/10_Confidence_0.026_Length_393|Name=BAP2ALocus_1052_Transcript_5/10_Confidence_0.026_Length_393|organism=Venturia canescens|type=mRNA|length=393bp
GTGCGAACTCCGAGCACAGTAATCGCGGTGCATCGTAGCACGCGAAAAAC
GCGAATGCCGGTGGACGCGCGTCGCGAGTCCCCGTCCAACTGTATATAAC
TGTGAATAGTGCATTTAAGATTAAAAAATAACATGTATATGTGCAACGCA
TAGTTTTTAACGTTTTTAACAAAAACGGAAGAAGAAAAAAAACGCAAATT
CGAAGAGAAAGAAAACGAGAAAAAAAGAAACACGGTGGTGCGTCGGTCGA
AGTTATCGGTGTGACGAAGGTTGCATTACGCTGCGTATCTTGAGTTTGAC
CGATCTCCATCTTTCCGGAAATATATATCAAGGCGGTATTTGCTGTCGTG
TGTATCGAGAAAATAAATAAAGTCGACGACGTAGAACGAACCA
back to top