BAP2ALocus_1052_Transcript_8/10_Confidence_0.184_Length_3364 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1052_Transcript_8/10_Confidence_0.184_Length_3364
Unique NameBAP2ALocus_1052_Transcript_8/10_Confidence_0.184_Length_3364
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length3364
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1052_Transcript_8/10_Confidence_0.184_Length_3364 ID=BAP2ALocus_1052_Transcript_8/10_Confidence_0.184_Length_3364|Name=BAP2ALocus_1052_Transcript_8/10_Confidence_0.184_Length_3364|organism=Venturia canescens|type=mRNA|length=3364bp
GTGCGAACTCCGAGCACAGTAATCGCGGTGCATCGTAGCACGCGAAAAAC
GCGAATGCCGGTGGACGCGCGTCGCGAGTCCCCGTCCAACTGTATATAAC
TGTGAATAGTGCATTTAAGATTAAAAAATAACATGTATATGTGCAACGCA
TAGTTTTTAACGTTTTTAACAAAAACGGAAGAAGAAAAAAAACGCAAATT
CGAAGAGAAAGAAAACGAGAAAAAAAGAAACACGGTGGTGCGTCGGTCGA
AGTTATCGGTGTGACGAAGGTTGCATTACGCTGCGTATCTTGAGTTTGAC
CGATCTCCATCTTTCCGGAAATATATATCAAGGCGGTATTTGCGTAGTGT
CGTGTGTATCGAGAAAATAAATAAAGTCGACGACGTAGAACGAACCATCG
CAAGCCGAACTATGCAAATGTGGATCTGCAAAAAAACGTGAAAATAAAAG
AAACTCGGGTAAAAGAGACAAATAAAATCGAGTGAGAAGGAGCGTTCTAT
ATATACGAGTATTCGGACGCCGGTAATCACGACAAGATAACCTTCAACAA
GGGTTTTTCTCTGCATCTTGTTTTTTTTCTCCTCAATCTCGCGCCGACTC
GGGGGTTTTTCTTCATACATGTAGAAATATATATACACGCATATATCTAC
ACCCATATATATGTGTATATATATGGTATAGGTATACAATTCTCGACAAC
CTCGCTCTTCTCACCCTGTGCCTCCCTCCCCCCGCATTGCCCTGCGGTTC
CGCGCGCGCGGCGAGTAACAGTCGCCGAGGAGGCCCAGCATCGTCACTAC
AATCGTCATCATCATTATCATCATCAAGCCACTGCTAAAAATCTCAAGTG
GAAAAAAAAGGAGCGTACGTGGTGGTGCGGTTTGACAGAAGAATGAAGTG
GCTTGGTGCGGGAAGCGGCGGCGGTGGAGAGCCGGCACCCCCTATGCAGT
TGCACTATCCCTCGGCAAATGGTCACATACCCACAGACAACGAACAGTGC
GCTCAGGTTATGGCCGGAGGAGACGGCGTTCGCATACAACAAGGACAGAG
TCACCAAATGGGCATCAACAGAGCCCAAGATGACGCCATGGTCGGTTATG
TGTTCCAAAGACCCGCCGAACAAGATTACAACGCTCAGGCTAATTCTTTT
CAAACTAAACAAGCACCTAGAGCTTGGGCTCTCGCCGACGACTCAATCAT
TGACAATGTAAGTATGGCTGGTGCCTCCGGTGGTTCGAGCGGCGACGCCA
CCAATGGGTACCTCACGCCGGCTCTTCAAAATCATGAAAAGTGGAAATAT
CCCATGAACAAAATCGGTGTACCGCAGCAGAGTCAACCTCAACAAATCGG
CATTCAAGCCATGAACAATGTTCATCTGCCCTATGAAATACATCCTATGC
AGTTGAAGAGTGGCGCTCCAGGAACTGAGCACTTAGTTTATTTGAATAAT
CAAATGACGGCGCAGCAACAAGTCGCGCTATTTCACCATCAACAACAACA
GCAGCAGCAACAGCAGCAGCAACAGCAGCAGCAGCAACAACAGCAGCAGC
AACAGCAACAACAACAGCAGCAACAACAGCAACAGCAACAATTTCGAAAT
GGACAAGATAGCTGGCAGGATGCGGGACTGATTGCACCCTCGGCAAAAAA
GCTCTGGGGCGTCGATGAGGGCGGCTCCAAGGATGAAGGGGGTGTAAAAG
GCGGTGGGATACTTCATCTCGGCGACCACCAGATGTGGCGAGACCCAACC
TGGAGTACACCAGATCATGCAGTGTCACAACCGATTTCAATGGGAACGGG
AAGACGCGTTGGCGTTGGGACAGGATATCATCATCAGACGTCAGAAGTTG
GCGCTGTTCTTAGTCCCAGGAGCAGCGAAACTGGTGGGCTTGGTGTTAAA
ATGGTCGAATACGTCCTCGGTTCGAGTCCCACAACGCCCAAGGATTTGGA
GTCTCGAATGGTCTCTCTCAGGCTGAACCCGGAAGGTGATAAGAAAGAAA
AGGACAAAGGTACGGCGAGTCCATTCGACGGCTCGAAAGACGACAACGGG
CCTCAGGGCAACGGACTCGCATCACAGAATGGTCTCGACGATGACAAAGG
GTTCAATCGCACACCGGGAAGCAGACAACCGTCTCCGGGTGAGGAAGAAT
TTCAGAAGAACGCAGCAGCCACTTTGGCCGTCAGCACCGGAGGGGGTGGG
GTCGTGTTACTGAAGCCGGGAGTCGACGTGGTCGGAAGCGAGGAACATTT
TATGGCCGCTTTCGCGCCCGCGCCGCCTCACCATCTCCAGCATCACCAGG
CCCCCCCGGCTCATCATCTCCAGCATCCTCACTCACACGCTGCCCAACTT
TTTGGCGCTCAAGGCCCACCGCCGCCTCAAGGACCACCTCCGTCCCAGCA
GCAACAACAGCAACAGCAACAACAACAGGGACCACCCCAACAACAAGATA
CGACCACTCACTTTGATGTCCAGCAACTGTTCCGCAGTCAACCACAAGGA
GCGACGCCTCAACAACTCCAACTTTTGCAGCAACAGCAGCAGCAGCAACA
ACAACAACAATATCTTGCCGCATCGCAAGCTCAGCAGCAACAACAACAAC
AACAAAATTTTCCAACAGCACCGTACACGGTCATAAGTGGACAGGAACCT
TACGTCGGTGCTCTAATTGCTGGAGCTCCTCCCGTAGTGCCGCAATATTA
TGGAGTCGGGCCGTGGGTCTATCCAGCGGGTTTACTGCCACAAGCACCAC
CCCAGGCAGCCGCACCGCCACAACCCCGAAGACCACTCACACCCTCGTCC
GCGGCAGCCGCTGCTGCCGCTGCACAGGATAGCGCCAATAATCTTGCACA
GACGGTTCAGGGTCAATATCAGGTGATACCGGCTTATTACGACCAAAACG
GATCCATCGTTATGGGAGGCGTGAGAGGCCTCGGTTCTGCAGCCACACCC
ATGAGATTGGTTAGTCCGGCGCCCGTACTCGTCAACAGAGCACCTTCTCA
ACCACCTCCAGGACCTCCGGCTCCACCGCCACCGAGCCTATATTCGCAAC
CAACCCCAACGTCGGCACACAGCAACGCCACGCCTGGCGAGTGCTTAGGT
CTGGCAGCGTGCAGCGCAGTGGTTGCGCAAGCTCAGGCGGTTGCGGTACA
ACAGGCCCAACAGCAGAGCTCGGGACTTGCCGCGGGTTTGGCGGCTTTGA
GTTACAGTGGTTCACCTCTCGGTGCCCTCGGCTCCCCGGCTCAACTACAG
AGCACAGGTCTCGGTTTGAGTGCATCGTCAACCGGTAGAAGGGATTCTTT
CGACAGGAACACTTCGGCTTTCAGCCCAAGCTTGGAATGCAGTCGTGCCA
AATGGGCTCAAAGT
back to top