BAP2ALocus_1053_Transcript_2/4_Confidence_0.545_Length_2355 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1053_Transcript_2/4_Confidence_0.545_Length_2355
Unique NameBAP2ALocus_1053_Transcript_2/4_Confidence_0.545_Length_2355
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2355
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1053_Transcript_2/4_Confidence_0.545_Length_2355 ID=BAP2ALocus_1053_Transcript_2/4_Confidence_0.545_Length_2355|Name=BAP2ALocus_1053_Transcript_2/4_Confidence_0.545_Length_2355|organism=Venturia canescens|type=mRNA|length=2355bp
TTTTTTTTTATTGATCTTCGATTAAATTTATTTTATATTCTAACAATAAT
AAAATGCGGCAAAAAGAACAGTTCTCGCGTAATGTCACATGATCATGCGT
TACATCGTATGAATACAACACAAAGGTATTGACGCGTATAGAATACATGC
TCGAGGACCCACAATTATCTAATTATTTTTTACCTAATAGAAAGCTATTA
ATAAAATAGTTCATCTCATTCAAGCGATTGCATAATCATCGCTCAGTTAA
TAAAATAATAGTGCAATGACATACAACTATAATTGCTTCTGATTCCATTG
TATAATTAACGTGTTAATTTTCTCAATTATATTATCATCATCATTGTTAT
TTTTGTTGTTATATTACTGTTATTATTGTTGCTGTGGTTTCGTGGAAAAT
ATTACGAGGCATGAAATGCCTCGGTGTGCATCGGATTATTCTAGGGTGGT
CGCAAAGGCCACAATAGTTTCTCCAAGTATTTATGTCGACGATTCCATTA
TAATTTATCGTCTTACCTCTTTTTTTTCCCAATATTCGTATTTTACATAA
CATTTTTCAATTTAATTTACGATCCGACAGCGCGCTCATTGATTCGTCAC
TCGTCATTCAAATTCATTTTCATTACGTCATGAGGCGTATACAATTCATT
CGTTAAAATCATTAGTTTTCTTCATCATTCAAAATACAGCCGAGACTTGA
GCTGATTGTTTATCTACAAATCGTTATTTCATTCAATCGTTATTATTATT
ATATATATATATTTACGTTGGTATTTATATATATAATTTTAATCTGCATC
CGATTGCTTTTGGGAACGCCTCTTTTTGTATAAATTCTCAGAGATCCCCC
CCATTTTTTACCACTTATATAACAAATCTATTCTGCAATTAGTCATTTGC
TCACTGAATCTTCTCGTCGACATAAGCCGTTATCGCTGCTTGACACTCGG
CCGAACACCAGTGTTGAACCAACAGATAACTCTCCGATTCAAGAGCGGCG
TCCAATTTTTTTCTCAAGTTGTGACGAAGCAGGGCCTTCGTTGCTTCCAT
TGACTGAGACGACTGTTCGCTCATGGCTCGTAACGATGGTAAAAGCTCGT
CCTTGAAGCGGTCCGGCCAAAGGACTCTCGTCACTAAACCTGCTCGGAGT
GCCTCGTTAGCTGTTAAGGTTCGACCGCCCAACAGAAGTTCGCTCGTGAC
CGAGCTTCCAAGAATGTGTGAAAGTGTGAAAACAGCAGCTCCTTCGGCAA
TTTGTCCAAGTTTTCCGTAAGGAGTACTGAAAGTCGCTTTGTCACTCGCA
ATTACAAGATCGAACCAGGGCAACATCGTAACTCCAAGGCCAATCGCGGT
GCCTTGAACTCCTGCGACGATTGGCTTGTTAAATGTTGCCAAACTCTTAA
TAAATTCTTTGACAGCGTTGGCGAGTTCCTCGGCACGTTGACGTCTCTCA
TCCTTCTCTTCGTGCAAAAGAGTTGAGAGTTCGAGTCCCTCACAAAAACT
CGTACCCGTCGATGTCAATAAAACGACTCGACACTCCTCATCTTTTTTCA
GTATCGAGAGATTTTCTCGAATTTCTTGCATCACCTGAAGAGTTATTCCG
TTTCGTATTTTCGTCGAGGTCGAGGGGGTCAATAACAATTGCACGAGTTT
GCCGTGACGCTGAACCGTTATTTCATTATTGCTAAATTGTACTCTAGGTT
CTGTGTTGAATTGTTTCTCATCGAAATCCAAACTCTTCGCAACACTGCTC
GGATTACCAATTTGTCGTAACGACGTCCTTTCAGAGATCCTAAACGAGTT
TCGAGAGCATTATCCTCGTCGTGTGAAGAATTCCAACACTGTACCGTGCC
GCAGTTGAAGATAACAAATATTTGATGAATTTGTCGTGATTTTCCTTTTT
ATCTTTCTCTTTCAAAGAAAAGTACGATGATAAAATCAGCAGCACTTTTT
GTTCGTTCAAGCCCAAGAGAAAAATAATCCGTAATACAAGTACAATGTAA
ACATGAAGTATAGCTGATTAGAGAGCCTGTCCGGTCTCTCTTGTGCACAA
TCCACGTAAATTCATAGTTACTTGTATGCACTAGAAATACACATAAAACA
CGCACGAACGCCTTAAATCCCGGAATTAGAAAAGAAGCTAGTATGATTCC
ATTTATTAACAAGAACAAAATGAAAGATATGCACAACACGCGTTTTGAAT
AAGTTGTTTATATCTTGTTGTGTTCCGAATTTATGTAATATAATTCGATA
CGGTACTGTTGTTGTTTGATTGTGCTTGGGCGATTAAATTTTCACAACAA
AACCGTGAAAGAGAAAGATAAAAAGGAAAATCACGACAAATTCATCAAAT
ATTTG
back to top