BAP2ALocus_1053_Transcript_3/4_Confidence_0.545_Length_5380 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1053_Transcript_3/4_Confidence_0.545_Length_5380
Unique NameBAP2ALocus_1053_Transcript_3/4_Confidence_0.545_Length_5380
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length5380
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1053_Transcript_3/4_Confidence_0.545_Length_5380 ID=BAP2ALocus_1053_Transcript_3/4_Confidence_0.545_Length_5380|Name=BAP2ALocus_1053_Transcript_3/4_Confidence_0.545_Length_5380|organism=Venturia canescens|type=mRNA|length=5380bp
ACTACTGGTGGCTGCAAAAATATACGTTCGACGACGACGGTAGCGTCGCT
CAGTCATTTCGATGTCAAAAGCAAACAATGTGCGACAGGAATGAGTTTTG
CGGATACGTGAGGGCTGATATTTTTTCAGTGTATTATCGCTGCGCGTGTC
CTGAGAGACATTTGTGCATAACGAAAGATCGCAAGAGAGAAAACGTTAAT
GAATTTTTGTACAGTGGACCGGCTTATAAAGCCTACTGCGTGCCATGGGA
TTAGAAGAAACAGTTTTGTAAGGAACATGGAAAATACCAAGATTAATGCA
ATCGCAAAGAATATTTTACCTGAGACGACTGTTCGCTCATGGCTCGTAAC
GATGGTAAAAGCTCGTCCTTGAAGCGGTCCGGCCAAAGGACTCTCGTCAC
TAAACCTGCTCGGAGTGCCTCGTTAGCTGTTAAGGTTCGACCGCCCAACA
GAAGTTCGCTCGTGACCGAGCTTCCAAGAATGTGTGAAAGTGTGAAAACA
GCAGCTCCTTCGGCAATTTGTCCAAGTTTTCCGTAAGGAGTACTGAAAGT
CGCTTTGTCACTCGCAATTACAAGATCGAACCAGGGCAACATCGTAACTC
CAAGGCCAATCGCGGTGCCTTGAACTCCTGCGACGATTGGCTTGTTAAAT
GTTGCCAAACTCTTAATAAATTCTTTGACAGCGTTGGCGAGTTCCTCGGC
ACGTTGACGTCTCTCATCCTTCTCTTCGTGCAAAAGAGTTGAGAGTTCGA
GTCCCTCACAAAAACTCGTACCCGTCGATGTCAATAAAACGACTCGACAC
TCCTCATCTTTTTTCAGTATCGAGAGATTTTCTCGAATTTCTTGCATCAC
CTGAAGAGTTATTCCGTTTCGTATTTTCGTCGAGGTCGAGGGGGTCAATA
ACAATTGCACGAGTTTGCCGTGACGCTGAACCGTTATTTCATTATTGCTA
AATTGTACTCTAGGTTCTGTGTTGAATTGTTTCTCATCGAAATCCAAACT
CTTCGCAACACTGCTCGGATTACCTTTGGTTTTGTTACGATTGACAGGGA
CGGTACTTCTGCTTCGGGAAGACCCTCCACTGTCGTTCGAGAGTGCGGTG
ACCGCCTCGGCCAAACAAGCAGACAATTCGTCTTGTTGTCCGGGCGAGTC
CATTTTTTTATAAACCGATTCGTTTCCTTTGGCAAAGGTGACTTTGCACT
TGGCCGGTTTCTTACTTTTTGATATTATTTTTCCAGCGCTCGTAGTCAAC
GATGCATTGGATCTGGTTGCGACTTTACCGGAGTTTCCGGCAATGTTTTC
ATCGATGTCGATTATATCAACGGTTAGGTGTTTCAAAGATTTTTGATTTT
TTTTAAGATCAATTTTTTTCAATTTTACAGGCGTCAAAGTGGGAGAACTG
TCACTCGAAGTGGAAAAGTTGGTCGGAGTCGAGCCGGCAGTTTTATTGGT
TTTCAACGGAACGTTGAAAATTGGTACAGCTTCGTCCTCGTTAGATTTCG
TTTCGGATTCAGATCGCTCAGTAATTTTTCGTCGGTTCTTTTTAGGTTCG
GGTGATTGTTTGGGTTTTTTCTTTTTCTTCTCATCCTCGTGTGAAAGTCG
ACGCTTGTTGGATCTCAGGGCATGAGACGTTGAATTCACATCGTCGATCG
ATAGGCGTTCAGGTCCATCGATACTCGCTCTCGGACTCACGGATGCACTT
GAAAACGAGCTGGACGAATGCCTTCTTATGATAACCGAAGCATCCGCTGC
GTTACGAATTTTCGCTGGGTATATGAAATCGGTGGGTGACGTTGGCAATG
CGATTTTCGAATCGCTCGTTTTTTTCTCTGCGTAAAAATCGCTGCTGTGA
GAAATCGATCTTTTCGATCGCGGCGATACCTTATTCGTCGGAATATTTGA
CGTTCGCAGCCTGAGAACGGCGTTGCGTACAAGTTTCGTACGAATTTTTA
ACTCTCGTTGAATCTTTTGCAGATCCATCACTTTAGTTTGTGATTTTGTA
ATCGGTACTAAACGCTTTTTATCTGGTTGCTCCACGTCGTAGAGAAGGTT
AACGACGCCCTCGTCTTGCAGCAACCTGTCGATCTCGTTGATCACTTTTT
TCTTTGGTTTACCTTCTGCTTGTGAAGTTTCGCCGTTACGCTGTTTCTGT
CCTTTCCCAGTTGCCATTTTGGTCCCAGTCTTTTTGGCGATACCTTTCGT
AATTTTGCCCACTGTAGATTTTTTGCTAATCGTTATTTTTTGTTTCGCTT
GGCCAGTTGGCATTTTTCTTTTGGTGCTCGGCTTCAAAACGACTTTTTTA
TTAATGGGCTCAGAACTCGACTCCTCGTTGTGAGAATCCAACGGGCTCTC
GAGCGTTGTCTCGTCGATGTGTTTTTTTGCTACCTCGTCGAATTTCTCCG
ACACACTTTCGTCGATTGTTTCATTTTTACGAATCGCCGAATCATTGATC
GTGGGAGATTGCTCATCTTCTTGACTCTTTCGTTTGTTCAACGATGTTTT
ACCCTTTGACACTTTCATACGTTTCGTACTGTTTTCGTGTTCTCGGGCCT
TCTCCGTCGGTTTCCGTTTTCTGCCTGACCTCGTTTCGTCAGATTTATAC
TCTTGTGACGACAGATTCGAATCCATGGAATCCTCTTTGAATGTGGATTC
GGGGTTCATCACGTTCGACACCGTCATCGTCGTCGTTGTTTCTCCCTCTC
CAATAATTCCGCTGATTTGAGCCGGTGTGTCCTTCGGCTTCGTTACATTG
GGTGCTTTGGTCCGGGGAGCCTTCGTCGGAGTTTTCTTTATCGCTACTTT
TTTCGAAGGACTACTCGGCAATTCGAGAAGTTGTTTGAGAGCCATTTCTC
GCTCGATCACCGGATCCAACTTTGTCGAAGTGTTTCGTTCCGCTGCTGCT
CCGGATTTGGCTTCCTCGACCACGGAATTTGGCACTTTTAAATTCGACCA
ATCAGGGTCAACGTCGCCTTCCAATATTGCGAGCAATTCTTTGTCCACGT
TGCTCGTCGTTTTTTTAACCTCGCTCGTAGTCGATGAGCTTTTGCTTATT
TGTGGTATCGGCAAAAGTCCAGGTACTTGAGCTGCCGAAGCCGCTGCAAG
TTTGTGCGACAAGCGTTGCGTTATTTTTTTAACGAAAAACAAATCAGGCT
TGGTCGGCGAATCGAATTCTTTTTGTTGTTCGCGTATGCGCTCTTTGAGG
ACTTTCGAAACGGCGCTTTTCGAAACTATTGGACTGGTCAACAAAATCCC
TGGCACTTTGACTCCCGGTCGCGGTGCTAAAGGCTTTTGTTTTATCAACC
TTTCTCGAGCCATTGGAAATTCGCTCGATTTCTCTGATTTTCGTGGCTCC
ATCTGTTCCGTCGATTCCTCAACCCTCGACGAGTCGATGTTTCTTTTTTC
ACAAGCTTCCCCTTCGACTGGCTTGACACTATCTCGCTTCAAAGTTTCTC
CAATCGTAGTGCGTTCCCTCGAGCCAATCGATGACCTCGAATTACTCGAT
TTTTCTGTACATTCAGATATTCCATCTTTCATCCTGTTCGAACCTTTGTC
ATCATTTTTTATTTGACAAGATTCGTCGGTCGATTTTTCATCGTGCAGCA
AAATCTTCAATTCCATTTCTACGGAATCGTGAGACTTTGACAGCTGCTGC
GATGCCTCATCTTCGACATTGTCGTCCTGCCAGTCGTCATAAATGTCCTC
AATCACGCTACGCTGTTTCAACGGATTTTCGGACGGCGTTGATATCCTCG
AGCAGGAGGAGTCGCTCGTTTTCTCCGCTTCCGGTGATTCTCCATTCTTT
AATGCCTCTCGTGGGTCCAACGTTTGTTCCACATTTTCATTCCTACTTAT
CGACTTTTCAGAAATTAAATGCTCATTCGGTGACTCCTCTCTCTCAGCGG
TCACAATTGTTTCATTTTTTATTGCACTTTCAATCTCAACGGACTGAATC
CCATTCGCGTTACTTTCCTCGCTCGATTGTACGGACAATTCGAAACTCTC
TGTCACAGATTCTTGAGTTTTATCTGTGTATTCCACGATTTCTATTATTT
CTGTACTTTGCTCGATCGTGGAAACTTTTTGTGTCGTTTTTTCGGTAACC
ACCGGTACATCGACGCCAATTTCTTTGACGTCAACTTCGGACGACATATT
TTCTACCACATTAGAACCATCTTTCGAGTCTTCGCATACTTGTGATTCCG
CACATTTGTTGATTGGGGCATTTTCCTCATTCTTTTTTGCCTCGCTCCCT
GTTGCAGAAGCAATACAAATATCAGGCACTAAATTCTCGTTGGTAGGTAT
TTGGTTATCCGTTTCGTTTGAGCCGTCATTTGTATTGCTTTTATCGTTGA
TTTTTTCCACCATTAAATCATTGGCCTCCCTAAACGTTGCCAATCCTTCT
CCATCATCCTTGTCGGCCTTGCTCGGATATGTTTTATCGATTCTTTCATT
TTTGTCTTCCTCACCATTCCTGGTGGACTTGAATTCTACAATGTTTTTGT
CAATATTTCCATCAGAGTTCATCTTCTCTTCCGCCTCTTCCAAAGAACAC
TTTCCATCGTCGGTGATTATTTCTGCAGATTGTTTTCCCTTATCGTTAGA
ATTCTCCTCTCTTTTATCCACCGATTCTCCTCCAGCTGGAAAATCAGCAT
GCCCCTCAGATTTTAGAACTGTTTCTTCTACTGTTGTTGTTTGTGGTACT
GGTTCTATGCTTGATGGCGCTGCTATCAGGTTTCGGTCATCCATGTTTGA
ATTTTTGATACGTTATTCACTCATCGAGTTTCCAATTTGTCGTAACGACG
TCCTTTCAGAGATCCTAAACGAGTTTCGAGAGCATTATCCTCGTCGTGTG
AAGAATTCCAACACTGTACCGTGCCGCAGTTGAAGATAACAAATATTTGA
TGAATTTGTCGTGATTTTCCTTTTTATCTTTCTCTTTCAAAGAAAAGTAC
GATGATAAAATCAGCAGCACTTTTTGTTCGTTCAAGCCCAAGAGAAAAAT
AATCCGTAATACAAGTACAATGTAAACATGAAGTATAGCTGATTAGAGAG
CCTGTCCGGTCTCTCTTGTGCACAATCCACGTAAATTCATAGTTACTTGT
ATGCACTAGAAATACACATAAAACACGCACGAACGCCTTAAATCCCGGAA
TTAGAAAAGAAGCTAGTATGATTCCATTTATTAACAAGAACAAAATGAAA
GATATGCACAACACGCGTTTTGAATAAGTTGTTTATATCTTGTTGTGTTC
CGAATTTATGTAATATAATTCGATACGGTACTGTTGTTGTTTGATTGTGC
TTGGGCGATTAAATTTTCACAACAAAACCGTGAAAGAGAAAGATAAAAAG
GAAAATCACGACAAATTCATCAAATATTTG
back to top