BAP2ALocus_1053_Transcript_4/4_Confidence_0.727_Length_6114 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1053_Transcript_4/4_Confidence_0.727_Length_6114
Unique NameBAP2ALocus_1053_Transcript_4/4_Confidence_0.727_Length_6114
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length6114
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1053_Transcript_4/4_Confidence_0.727_Length_6114 ID=BAP2ALocus_1053_Transcript_4/4_Confidence_0.727_Length_6114|Name=BAP2ALocus_1053_Transcript_4/4_Confidence_0.727_Length_6114|organism=Venturia canescens|type=mRNA|length=6114bp
TTTTTTTTTATTGATCTTCGATTAAATTTATTTTATATTCTAACAATAAT
AAAATGCGGCAAAAAGAACAGTTCTCGCGTAATGTCACATGATCATGCGT
TACATCGTATGAATACAACACAAAGGTATTGACGCGTATAGAATACATGC
TCGAGGACCCACAATTATCTAATTATTTTTTACCTAATAGAAAGCTATTA
ATAAAATAGTTCATCTCATTCAAGCGATTGCATAATCATCGCTCAGTTAA
TAAAATAATAGTGCAATGACATACAACTATAATTGCTTCTGATTCCATTG
TATAATTAACGTGTTAATTTTCTCAATTATATTATCATCATCATTGTTAT
TTTTGTTGTTATATTACTGTTATTATTGTTGCTGTGGTTTCGTGGAAAAT
ATTACGAGGCATGAAATGCCTCGGTGTGCATCGGATTATTCTAGGGTGGT
CGCAAAGGCCACAATAGTTTCTCCAAGTATTTATGTCGACGATTCCATTA
TAATTTATCGTCTTACCTCTTTTTTTTCCCAATATTCGTATTTTACATAA
CATTTTTCAATTTAATTTACGATCCGACAGCGCGCTCATTGATTCGTCAC
TCGTCATTCAAATTCATTTTCATTACGTCATGAGGCGTATACAATTCATT
CGTTAAAATCATTAGTTTTCTTCATCATTCAAAATACAGCCGAGACTTGA
GCTGATTGTTTATCTACAAATCGTTATTTCATTCAATCGTTATTATTATT
ATATATATATATTTACGTTGGTATTTATATATATAATTTTAATCTGCATC
CGATTGCTTTTGGGAACGCCTCTTTTTGTATAAATTCTCAGAGATCCCCC
CCATTTTTTACCACTTATATAACAAATCTATTCTGCAATTAGTCATTTGC
TCACTGAATCTTCTCGTCGACATAAGCCGTTATCGCTGCTTGACACTCGG
CCGAACACCAGTGTTGAACCAACAGATAACTCTCCGATTCAAGAGCGGCG
TCCAATTTTTTTCTCAAGTTGTGACGAAGCAGGGCCTTCGTTGCTTCCAT
TGACTGAGACGACTGTTCGCTCATGGCTCGTAACGATGGTAAAAGCTCGT
CCTTGAAGCGGTCCGGCCAAAGGACTCTCGTCACTAAACCTGCTCGGAGT
GCCTCGTTAGCTGTTAAGGTTCGACCGCCCAACAGAAGTTCGCTCGTGAC
CGAGCTTCCAAGAATGTGTGAAAGTGTGAAAACAGCAGCTCCTTCGGCAA
TTTGTCCAAGTTTTCCGTAAGGAGTACTGAAAGTCGCTTTGTCACTCGCA
ATTACAAGATCGAACCAGGGCAACATCGTAACTCCAAGGCCAATCGCGGT
GCCTTGAACTCCTGCGACGATTGGCTTGTTAAATGTTGCCAAACTCTTAA
TAAATTCTTTGACAGCGTTGGCGAGTTCCTCGGCACGTTGACGTCTCTCA
TCCTTCTCTTCGTGCAAAAGAGTTGAGAGTTCGAGTCCCTCACAAAAACT
CGTACCCGTCGATGTCAATAAAACGACTCGACACTCCTCATCTTTTTTCA
GTATCGAGAGATTTTCTCGAATTTCTTGCATCACCTGAAGAGTTATTCCG
TTTCGTATTTTCGTCGAGGTCGAGGGGGTCAATAACAATTGCACGAGTTT
GCCGTGACGCTGAACCGTTATTTCATTATTGCTAAATTGTACTCTAGGTT
CTGTGTTGAATTGTTTCTCATCGAAATCCAAACTCTTCGCAACACTGCTC
GGATTACCTTTGGTTTTGTTACGATTGACAGGGACGGTACTTCTGCTTCG
GGAAGACCCTCCACTGTCGTTCGAGAGTGCGGTGACCGCCTCGGCCAAAC
AAGCAGACAATTCGTCTTGTTGTCCGGGCGAGTCCATTTTTTTATAAACC
GATTCGTTTCCTTTGGCAAAGGTGACTTTGCACTTGGCCGGTTTCTTACT
TTTTGATATTATTTTTCCAGCGCTCGTAGTCAACGATGCATTGGATCTGG
TTGCGACTTTACCGGAGTTTCCGGCAATGTTTTCATCGATGTCGATTATA
TCAACGGTTAGGTGTTTCAAAGATTTTTGATTTTTTTTAAGATCAATTTT
TTTCAATTTTACAGGCGTCAAAGTGGGAGAACTGTCACTCGAAGTGGAAA
AGTTGGTCGGAGTCGAGCCGGCAGTTTTATTGGTTTTCAACGGAACGTTG
AAAATTGGTACAGCTTCGTCCTCGTTAGATTTCGTTTCGGATTCAGATCG
CTCAGTAATTTTTCGTCGGTTCTTTTTAGGTTCGGGTGATTGTTTGGGTT
TTTTCTTTTTCTTCTCATCCTCGTGTGAAAGTCGACGCTTGTTGGATCTC
AGGGCATGAGACGTTGAATTCACATCGTCGATCGATAGGCGTTCAGGTCC
ATCGATACTCGCTCTCGGACTCACGGATGCACTTGAAAACGAGCTGGACG
AATGCCTTCTTATGATAACCGAAGCATCCGCTGCGTTACGAATTTTCGCT
GGGTATATGAAATCGGTGGGTGACGTTGGCAATGCGATTTTCGAATCGCT
CGTTTTTTTCTCTGCGTAAAAATCGCTGCTGTGAGAAATCGATCTTTTCG
ATCGCGGCGATACCTTATTCGTCGGAATATTTGACGTTCGCAGCCTGAGA
ACGGCGTTGCGTACAAGTTTCGTACGAATTTTTAACTCTCGTTGAATCTT
TTGCAGATCCATCACTTTAGTTTGTGATTTTGTAATCGGTACTAAACGCT
TTTTATCTGGTTGCTCCACGTCGTAGAGAAGGTTAACGACGCCCTCGTCT
TGCAGCAACCTGTCGATCTCGTTGATCACTTTTTTCTTTGGTTTACCTTC
TGCTTGTGAAGTTTCGCCGTTACGCTGTTTCTGTCCTTTCCCAGTTGCCA
TTTTGGTCCCAGTCTTTTTGGCGATACCTTTCGTAATTTTGCCCACTGTA
GATTTTTTGCTAATCGTTATTTTTTGTTTCGCTTGGCCAGTTGGCATTTT
TCTTTTGGTGCTCGGCTTCAAAACGACTTTTTTATTAATGGGCTCAGAAC
TCGACTCCTCGTTGTGAGAATCCAACGGGCTCTCGAGCGTTGTCTCGTCG
ATGTGTTTTTTTGCTACCTCGTCGAATTTCTCCGACACACTTTCGTCGAT
TGTTTCATTTTTACGAATCGCCGAATCATTGATCGTGGGAGATTGCTCAT
CTTCTTGACTCTTTCGTTTGTTCAACGATGTTTTACCCTTTGACACTTTC
ATACGTTTCGTACTGTTTTCGTGTTCTCGGGCCTTCTCCGTCGGTTTCCG
TTTTCTGCCTGACCTCGTTTCGTCAGATTTATACTCTTGTGACGACAGAT
TCGAATCCATGGAATCCTCTTTGAATGTGGATTCGGGGTTCATCACGTTC
GACACCGTCATCGTCGTCGTTGTTTCTCCCTCTCCAATAATTCCGCTGAT
TTGAGCCGGTGTGTCCTTCGGCTTCGTTACATTGGGTGCTTTGGTCCGGG
GAGCCTTCGTCGGAGTTTTCTTTATCGCTACTTTTTTCGAAGGACTACTC
GGCAATTCGAGAAGTTGTTTGAGAGCCATTTCTCGCTCGATCACCGGATC
CAACTTTGTCGAAGTGTTTCGTTCCGCTGCTGCTCCGGATTTGGCTTCCT
CGACCACGGAATTTGGCACTTTTAAATTCGACCAATCAGGGTCAACGTCG
CCTTCCAATATTGCGAGCAATTCTTTGTCCACGTTGCTCGTCGTTTTTTT
AACCTCGCTCGTAGTCGATGAGCTTTTGCTTATTTGTGGTATCGGCAAAA
GTCCAGGTACTTGAGCTGCCGAAGCCGCTGCAAGTTTGTGCGACAAGCGT
TGCGTTATTTTTTTAACGAAAAACAAATCAGGCTTGGTCGGCGAATCGAA
TTCTTTTTGTTGTTCGCGTATGCGCTCTTTGAGGACTTTCGAAACGGCGC
TTTTCGAAACTATTGGACTGGTCAACAAAATCCCTGGCACTTTGACTCCC
GGTCGCGGTGCTAAAGGCTTTTGTTTTATCAACCTTTCTCGAGCCATTGG
AAATTCGCTCGATTTCTCTGATTTTCGTGGCTCCATCTGTTCCGTCGATT
CCTCAACCCTCGACGAGTCGATGTTTCTTTTTTCACAAGCTTCCCCTTCG
ACTGGCTTGACACTATCTCGCTTCAAAGTTTCTCCAATCGTAGTGCGTTC
CCTCGAGCCAATCGATGACCTCGAATTACTCGATTTTTCTGTACATTCAG
ATATTCCATCTTTCATCCTGTTCGAACCTTTGTCATCATTTTTTATTTGA
CAAGATTCGTCGGTCGATTTTTCATCGTGCAGCAAAATCTTCAATTCCAT
TTCTACGGAATCGTGAGACTTTGACAGCTGCTGCGATGCCTCATCTTCGA
CATTGTCGTCCTGCCAGTCGTCATAAATGTCCTCAATCACGCTACGCTGT
TTCAACGGATTTTCGGACGGCGTTGATATCCTCGAGCAGGAGGAGTCGCT
CGTTTTCTCCGCTTCCGGTGATTCTCCATTCTTTAATGCCTCTCGTGGGT
CCAACGTTTGTTCCACATTTTCATTCCTACTTATCGACTTTTCAGAAATT
AAATGCTCATTCGGTGACTCCTCTCTCTCAGCGGTCACAATTGTTTCATT
TTTTATTGCACTTTCAATCTCAACGGACTGAATCCCATTCGCGTTACTTT
CCTCGCTCGATTGTACGGACAATTCGAAACTCTCTGTCACAGATTCTTGA
GTTTTATCTGTGTATTCCACGATTTCTATTATTTCTGTACTTTGCTCGAT
CGTGGAAACTTTTTGTGTCGTTTTTTCGGTAACCACCGGTACATCGACGC
CAATTTCTTTGACGTCAACTTCGGACGACATATTTTCTACCACATTAGAA
CCATCTTTCGAGTCTTCGCATACTTGTGATTCCGCACATTTGTTGATTGG
GGCATTTTCCTCATTCTTTTTTGCCTCGCTCCCTGTTGCAGAAGCAATAC
AAATATCAGGCACTAAATTCTCGTTGGTAGGTATTTGGTTATCCGTTTCG
TTTGAGCCGTCATTTGTATTGCTTTTATCGTTGATTTTTTCCACCATTAA
ATCATTGGCCTCCCTAAACGTTGCCAATCCTTCTCCATCATCCTTGTCGG
CCTTGCTCGGATATGTTTTATCGATTCTTTCATTTTTGTCTTCCTCACCA
TTCCTGGTGGACTTGAATTCTACAATGTTTTTGTCAATATTTCCATCAGA
GTTCATCTTCTCTTCCGCCTCTTCCAAAGAACACTTTCCATCGTCGGTGA
TTATTTCTGCAGATTGTTTTCCCTTATCGTTAGAATTCTCCTCTCTTTTA
TCCACCGATTCTCCTCCAGCTGGAAAATCAGCATGCCCCTCAGATTTTAG
AACTGTTTCTTCTACTGTTGTTGTTTGTGGTACTGGTTCTATGCTTGATG
GCGCTGCTATCAGGTTTCGGTCATCCATGTTTGAATTTTTGATACGTTAT
TCACTCATCGAGTTTCCAATTTGTCGTAACGACGTCCTTTCAGAGATCCT
AAACGAGTTTCGAGAGCATTATCCTCGTCGTGTGAAGAATTCCAACACTG
TACCGTGCCGCAGTTGAAGATAACAAATATTTGATGAATTTGTCGTGATT
TTCCTTTTTATCTTTCTCTTTCAAAGAAAAGTACGATGATAAAATCAGCA
GCACTTTTTGTTCGTTCAAGCCCAAGAGAAAAATAATCCGTAATACAAGT
ACAATGTAAACATGAAGTATAGCTGATTAGAGAGCCTGTCCGGTCTCTCT
TGTGCACAATCCACGTAAATTCATAGTTACTTGTATGCACTAGAAATACA
CATAAAACACGCACGAACGCCTTAAATCCCGGAATTAGAAAAGAAGCTAG
TATGATTCCATTTATTAACAAGAACAAAATGAAAGATATGCACAACACGC
GTTTTGAATAAGTTGTTTATATCTTGTTGTGTTCCGAATTTATGTAATAT
AATTCGATACGGTACTGTTGTTGTTTGATTGTGCTTGGGCGATTAAATTT
TCACAACAAAACCGTGAAAGAGAAAGATAAAAAGGAAAATCACGACAAAT
TCATCAAATATTTG
back to top