BAP2ALocus_1054_Transcript_2/2_Confidence_0.600_Length_3230 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1054_Transcript_2/2_Confidence_0.600_Length_3230
Unique NameBAP2ALocus_1054_Transcript_2/2_Confidence_0.600_Length_3230
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length3230
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1054_Transcript_2/2_Confidence_0.600_Length_3230 ID=BAP2ALocus_1054_Transcript_2/2_Confidence_0.600_Length_3230|Name=BAP2ALocus_1054_Transcript_2/2_Confidence_0.600_Length_3230|organism=Venturia canescens|type=mRNA|length=3230bp
TACATTGCCAAATTTTTACTCTTCCCCCTTTCTTTCTGTTTCTCGCTTTT
TGTATTATTTTTGGAATTTGAAAATTATCCTCACTTTTTTTTGGAACAAG
ACTTTTATTACTACGTTTTCCAGACGAATGAATAAATTAACGAGAAAAAT
AACGAAAAAAATGTCCGCAGGATACATTGCCAAATTTTTACTCTTCCCCC
TTTCTTTCTGTTTCTCGCTTTTACTTTGCAGAGTGTAGCTAATGACAATA
AATTGCGTGAGTGTATATTTGATAGTTAATATCGAAGTTCCTATAACATT
CAAGTTGAAAGTTGACTTGTAAGTAAATTTGAGGGAAAAAAACAAGAGTT
TACATTGGCCAAACTTAAACAATAATGCCGATGACTCGAAAAAATTTCAT
CTTTCGTTTGCTGTCTCTTTTTTTGCTAAGAGGGTTGTAAGAGTCTGTGG
TTTATCGCGGCAGAAAACGACAAAAAAGCCGCGGAGCGCTCTCTATCGAA
CATGTAATATTGGTATTTGTTTTGTTTGGTTTTTTTTATCTTTTATAAAA
CTCTTACGGAGCACGATTGAGCGTTTTACAATCAGCTAGCGTGTTATAGC
TAATTCTAGACGTTACAAATAGCAATTTCTTTTTTGTTGTTTTTTTCAAA
CTTTTTCTTTACTCTTACGAAATGCGACGGATTGCCCATTCATTTTCGGT
GTTCTCTTTATTTTCACTATTCGCCCTTCTGTCCAAAAAGCGAGTTGTTT
GACTGCTTTTTCTTTAATTTTTGTCAAACCCGAGATAATCATTTCCGTTT
GAAAGTTTGAAGAGACGGAAGAAGAAATTATTAATGCTTATCACGCCTCA
TTGGCGTCTTTCCCCGAACGTGCAAAGAACTTGCCTACATTCATATAAAT
ACCCTTCTTATTCCCGAAGAAAAACCCCTGTTGTATGGGAGGCAAAACCG
CAATTAATAATCACTTGTTAACTGTGTATGTGTGTGTGTGGGCGCGCGCA
TTTCACGGGTGCGTGAGTGCGTTGGCTACGCGTGTTCGTATTTACGAATA
AACAAGACTGCAAGCCAATATTTCCACGATTTTCAAGACTGATCAATGAT
CTGCCTTGCTTGTTCGATTTTCAATCCATTTGCGGCGAAAAAACTCCCAA
AAAGTCAGAGCGCTTATCAATATTTTATCGCAAAGATATTTTATGATTTC
TCGTTACTTAGATGAACAAGATTTTTTGTGGGTTTTGCTGCCTTTTTTGG
TGGCGAATTGCATTACTCTTTTTATTTTCATTCATTTTTCAACACTTTCT
AGTTTTTCCTTCTCATTTTGCCAACCTTATCCAGACCAGTCCGAATCTTC
CGAGTCTGAGAACACAAAGACCACTTCATCACGGTCGTCCATCATGACCC
ATTGATTATCACGCACCTCCAAGAAATTCCACAACAAGATGTGCTGCTCG
TAAAAGTCCCAATCATCATCAGAGGGTGGATCTTGTCGAACTGGTGGACC
AACGTCAGTTTTGGTGCCATCCGGTAGAGCATGAAGATAAAAACATTTGT
TGCCAAAGGGACATTTGCCACGACCTTTGTTGAAATATTTGCAGTCCTTG
AGGCTCAACGCTTCTTTGTACTCGACAATAAGTTTTTCTTTTTCCTCTTT
TGTATCGACCCAATACGTACTAGGACATACAAAGTCTGATGGTACACGAC
ACTCGGGACAGGAACGTATGATTTTATTTTCGAATTGCGTTGCTTGTCGC
CATTTTCTTATGCAACCGAGACAAAAACAATGATTGCAATTCGGCAGTAT
ACCAAATCTCTGTTCCGCCGTTGATTTCTCCATTATCACTTCAAAACAAA
CGCCGCAAGATTTGTCACGACTTCGTTGTATTGCGAACGAGAGCTCCATG
TCTGCTTCGTGCTGTTTTATACACGCATTCGTATGTTGTTGCCGCAACTC
ATCGTTAAACGGATGAAGCGCAGCTCTGCCACACATTTCACACATGATAC
CATGAAGATAAGGGCAGTCAATTTTTTTGCATATTCCACTTGCTTCCGCA
TAAGGACACAAAGGCTCAGAAGCTGGATTTGACGTCTGTCCCGAACTGCA
AACAGCCCTGGCATAAGAAGTTGGTGCTCCTGTTTTTGACGTTGATTCTT
CAGCACTAACATTCAACCCACTTGTTCCAAAAGAGGGTACGAATTCCGGT
GCTTTTACCCAATCTTCGGCAAGACGTGTTCCTTCCTTAGTCTTGTCTAG
AACGGATTCAGAAGAGGAAGAACTTGTAGAGGCACAGTCCGAGGTACCAA
CAGAAGATTCACCTCTGTTCAACTTTGAATTTGTTTTGGTGGTGTCTTCC
TTGGCACCGTGTGCAAAGCGACAATTTGCACCAAATTTGCAACTGCCCCA
TTTAAAAAATCGACAAGTGGTCGATGGGCCAGTAGTTCGAGGCGGCGTAT
CGTTAGTATTGCCAACAAGAGTGTCATTCGAGGCTACTCTTGCATGATTG
TATCGACAATTGTCACCTTCGCGACATATGCCATTTTTGTAATATCGGCA
AATAATGCTCTGTGTCCAATTGTCGGCCATTTGTGGAAGCACCAGAGCTC
ACGATTTGTTGATCCTCTTCCTCTCTCGAGGACGTTTCGTGAATCGTGAG
TCTTCCGATTAGCAGGATCACAGTTTGTTTTGTCGTCGTTTTTATCAAGT
TTTCGCAGAAATGCAAACGGCAATGAAACACACGAGGCTCCTCGTCAGAG
ATCCCTTGTCACGAAAAAAAGAATTCTCGTTTCGAGGGATCTCCGAAACT
CTTCGTGTGCTCTTTATCAACTTCGATGGAAATTCTTATTCTCTCCCTTC
TTCGTCTTCGAATAAAAAAACGGAACTTTCCAAGATCAGATGAAATTCTT
GAGGATAAGAAGCTTGAATACAATAGTAATAACGAAATCTTGATTCTTTC
TTTCACCGTTTATAAATTTGGGTTTGTTTTCCCAATAATAATAAAAGGCT
TTTCTTTTCTCAATCACTCTCGCAGTTCGGTTTCTCTGTTTGTTGTGTCG
TCTAATAAGCGCGCGCGCACACACCACGCAACTTTTTTCCCGAGCACATA
CACGAGTTTCATGAATGTATACACGAATACAAACACCAGAGAGAAAGACA
GAAAATGTCAGACACGAGCTCAGCACGAGCTGTTACGAAGAGCCTTGTGG
CATTATTATGTACTAACTCTTACTATAGTG
back to top