rna3681 (mRNA) Diuraphis noxia

You are viewing an mRNA, more information available on the corresponding polypeptide page

Unique Namerna3681
OrganismDiuraphis noxia (Russian wheat aphid)
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
JOTR01000065contigJOTR01000065:805597..808382 +
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Diuraphis noxia NCBI Gnomon annotation (20160302)2016-03-02
Property NameValue
Transcript idXM_015507616.1
Producttetratricopeptide repeat protein 4
Model evidenceSupporting evidence includes similarity to: 4 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns
Cross References
External references for this mRNA

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesTypePosition
LOC107161274gene2487Diuraphis noxiageneJOTR01000065 805597..808382 +

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesTypePosition
XM_015507616.1rna3681Diuraphis noxiapolypeptideJOTR01000065 805715..808382 +

The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
id32193id32193Diuraphis noxiaexonJOTR01000065 805597..805728 +
id32194id32194Diuraphis noxiaexonJOTR01000065 806372..806516 +
id32195id32195Diuraphis noxiaexonJOTR01000065 806614..806903 +
id32196id32196Diuraphis noxiaexonJOTR01000065 806980..807172 +
id32197id32197Diuraphis noxiaexonJOTR01000065 807242..807359 +
id32198id32198Diuraphis noxiaexonJOTR01000065 807442..807598 +
id32199id32199Diuraphis noxiaexonJOTR01000065 808199..808382 +

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
XP_015363102.1cds3584Diuraphis noxiaCDSJOTR01000065 808199..808382 +

The following sequences are available for this feature:

spliced messenger RNA

>rna3681 ID=rna3681|Name=XM_015507616.1|organism=Diuraphis noxia|type=mRNA|length=1219bp|location=Sequence derived from alignment at JOTR01000065:805597..808382+ (Diuraphis noxia)|Notes=Excludes all bases but those of type(s): exon.  
back to top

protein sequence of XM_015507616.1

>rna3681 ID=rna3681|Name=XM_015507616.1|organism=Diuraphis noxia|type=polypeptide|length=367bp
back to top

mRNA from alignment at JOTR01000065:805597..808382+

Legend: exonpolypeptideCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>rna3681 ID=rna3681|Name=XM_015507616.1|organism=Diuraphis noxia|type=mRNA|length=2786bp|location=Sequence derived from alignment at JOTR01000065:805597..808382+ (Diuraphis noxia)
acattagtatttcataatattcaaaaatgtaatattttgttttttaaatt ttgaacattgAACATCCTACTATCTAAAGCACTTTGTAAAGACTACCTAA CATTATTTTACAacgaaaatggaaaaaatattgtaagtatgatcattata attaaattgtcttcatgttataaaatgattacttacacaatattatattg tatatattttagatgttcataatatttattatttatttattgttacccGT GTTTGGTACTTTTTAgccgttataattatttaaatagttacttaaattat tcattgaacACATTCAAATAAGCTTATAAAAGCAGTTAAATTTCTAAAca cttaaaaaacattttaagaataattcatATCTTTAAAAAGTATCTTAAAT TTTTGGTTTCTGagaatatataacttaaaatttatgcATTTTCAGAAaag taaatttcaatttttttaataattaggaaagaaaaattaattaagtaaaa aaattattttaaaacgtgtMATACCTATGTTCTAATAAAATAgagatatg aaaataaaatcagaaaaaaactagaaaaaagcaattaaaacctccaaaat aagcaaaaataatcattttaaatttttaaatgtcatgtTATAACATGGTT TAAATTTCCAGAGCACTGCTAGATTTTATGTTAATCCAAATGAATTAGTC AATGCTTGAAATCCCTCACCTTGATAATTACTGATACAATTTTCTTTATA actttatcaatataattttttttagagaatCGAGTGGCTCTAAGAAGCCA ATGACGGATGAGGAACGTGAAAAACTTGCTAGTCGTCTCGATGAagattt agataattttatagaCAATCTACAGAAAACACCATATAAAGATGGTTGGA AAGAAGAGACTTGGCGTGaggtgataataatttatttttataattatcta gcttaaatacttttaactatcatttaatctttttaattatgtattgttta tttttatttttatttaggaaaTGGAAAAGCATCCATTTTTTATGACTAAA CCCCCTGAACCAGAAGACCAATTGTCTCCCTTAGTTGAGGGATTGCAAAA TCTTAGATATGATCCAGATGATAACACTCCCGAAGAGTTGGCAACAAAAC ATAAGGATGacggaaattttaattttaagtgtcGTAAATATAAATTGGCC ATAATGTCATATCAAGAAGGCCTTAAGTTAGATTTTCAAAACAATGATCT CCGTGctcaaatgtttaataatacgtctgcttcacattattttttaaaaa attttaggtattttatttaattagtgtttaatatattatgtaatttaaac atattgtatatttcttttatataatatgtttagatcAAGTTTGATAGCTG CTGAACAAGCGCTAAAATTGAAACCAGACTATGAAAAAACCATATTAAGG GCAATAAATTGTTGCATTCAGTTGAAAGAGTTTGATAAATGTTTAGattt ttgtgataaatatttgaagtttgTACCAGAGGATAGtaatatcatgaaaa taaaaaaagaagcaATCAAATCTAAAGTAAATTTGTGTAGTTAATAATTA AGActgatattattaggtatttattgtaatgtttaaaaTGGTTAGAAGAT CATGGAGatggaaaaaagaaaaattacaaaGATTCAGAAACAAAAAGAAG CGGATCAAGCTAAGTTGTTATTTGAgcttaataaaagaaaattgcaCATA GTTGGCAAAAATGGTAgttgtactttataatatttaatattgtattttgc atatatgatattaattttatttatttgttgatgaTTACACTTTAGATGGT CCAATTAAAGAATTAGCAATACTCGATCCAAGAGTGCCTGGTTTAGTACA GCCAGTACATTTAGTCGAAAATCGTCTTGTGTGGcctgttgtttttttat atccTGAATATAAAACTTCTGATATGGTCCAAGAGTTTTATGAAGATTCT ACGTCAGTATATTTTTGTCTATACacttatactttaatataatttaatat ttaaagagaAATTttctaactaaaatatattaaaactaaataatgtagta cttattatacatttttttcagttaacctaacttaataaatattttaataa taatttatttttcaaataatatttctataagctgggatattaattattag tgatAGGCAACAATatcgataatttaatataataccaatattgtGACAAA TTTTTGATATCAATATCCAAAATTATGTCCTTGCCCATCACTATTAATTA TGTTCCTATAGTTTTGTGTGTTGAATAAtgcattttgtaaaataaatttt taaaaagataaaaaaacagtaaattattaaaaaaattaagaaccagtagg gtatattattttttctaaatatttatgtcataatttaattcattagtttt tgattctaaaatttagatttttcaaattataagttatatgttgattaata tatattaaataatgtttttaactttaaaacaatagtttttagaaatttta tcgATTCATCCaatttttatgttgtaataattgttttaatatatttgtct aGATTTTATAGTCACTTAGTAGAAATGTTTTCTGAAAGACCAGAATGGGA TGTGGATGGAAAATACAATGCGGATGtagttaatgtttattttgaaattg taaataaatataaaactggcACCAAAGTCACAAAGATAGATTCAAAAACA TGCACATTGTTCGAAGCATTGACAATATTAaggtaa
back to top

Coding sequence (CDS) from alignment at JOTR01000065:805597..808382+

>rna3681 ID=rna3681|Name=XM_015507616.1|organism=Diuraphis noxia|type=CDS|length=1101bp|location=Sequence derived from alignment at JOTR01000065:805597..808382+ (Diuraphis noxia)
back to top