HiSeq1009 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq1009
Unique NameHiSeq1009
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length223
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq1009 ID=HiSeq1009|Name=HiSeq1009|organism=Ostrinia scapulalis|type=mRNA|length=223bp
GTAGAACTATTTTTACACAGCTTGCAATGTGTATCGGACTTAATTATATG
AGTTTCCTTTTTTTCTGATCAGTTGGATGAGTCACAGATGTGGTATCCAA
TTCCTAGTGAAAGGTGTTTTTAATTTCTTCGAATTGCCTTGACTCGTATA
TGATATTATTAAGAGTAAGGATTTACCTTGTAAGGTTGTGGTTCTTTGTT
TTAATTATTTAGTATAAATTTCT
back to top