HiSeq10091 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10091
Unique NameHiSeq10091
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length759
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10091 ID=HiSeq10091|Name=HiSeq10091|organism=Ostrinia scapulalis|type=mRNA|length=759bp
TCTGCAGCATCCTGCACTGAATGTTCTACTACTGTGATACAGTCTTAATT
AATAATTTACTTACTGCGTGTGTCCTTTATTTAATTTTGCTTTGGAAAAA
CCGCTGATCGCAAAAATATTTTTTATTTACAGTGTCTGAGCCAATGCATA
TTTGCTAATATACATGTCTCCAGAGACCATTCACGTCTCGGAATACAAAC
GTGCCTCCAAAGACTAAGTGGTGGTACCCATGAGACCTAGTAGATCTGAT
TGGGGAATCTCTAAATAAGAACAAAGGAAAATTTACATTACACATAGGGT
CGCCGCACACGGGCTTCACGCCACAGCTACAAACGCCGGCACAAGAAGTA
GCGACTACAAAAATAGTCTTTACTTTTACCTAATCCGCTCAAAAGGTTTG
TGCATTTTACACTAACACTGATCTTCTAAATTATACTTAAGTTCTAAGAA
GTAAGAACTAAGTTACTTATAAGTTTTTCAACTGAGTTTGTCCTTGCAGA
GGCCGAAGACAACGGTTGTTCGTACTCCAACAAACTGGAACGGTGTCTGA
TGCTACGCTTTTCCGATCGCCTGAAGTCAGACGCCAGCAAGACTCAATCG
GGAAACCAGAAAACAACAAAAAAATCTCACAAGTACAAAATTACTGGATA
GCCAGGATATGAGAAAGGTTGTGGATGATACACCAGGGGGCGCTCCAGAC
TTGCATTTTTTAATTCATGAGGATACAGCTGCTTAGGCAAAGGAATTGGA
GACTTGGCT
back to top