HiSeq10092 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10092
Unique NameHiSeq10092
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length917
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10092 ID=HiSeq10092|Name=HiSeq10092|organism=Ostrinia scapulalis|type=mRNA|length=917bp
CGGGTAAGCAAGACTTAAAGTACAATAAAAAAAAATCCTCCTCCCTACCT
ACATGTCTCCAGAGACCATTCACGTCTCGGAATACAAACGTGCCTCCAAA
GACTAAGTGGTGGTACCCATGAGACCTAGTAGATCTGATTGGGGAATCTC
TAAATAAGAACAAAGGAAAATTTACATTACACATAGGGTCGCCGCACACG
GGCTTCACGCCACAGCTACAAACGCCGGCACAAGAAGTAGCGACTACAAA
AATAGTCTTTACTTTTACCTAATCCGCTCAAAAGGTTTGTGCATTTTACA
CTAACACTGATCTTCTAAATTATACTTAAGTTCTAAGAAGTAAGAACTAA
GTTACTTATAAGTTTTTCAACTGAGTTTGTCCTTGCAGAGGCCGAAGACA
ACGGTTGTTCGTACTCCAACAAACTGGAACGGTGTCTGATGCTACGCTTT
TCCGATCGCCTGAAGTCAGACGCCAGCAAGACTCAATCGGGCAACCAGAA
AACAACAAACTAAAATGGGAAAAACCGGACTTAACTGGGATCACATTCAA
ACAAATGACATGAGTTACAACAATGGATGCTAATACTGTTAATTACTGAC
AAAACGTTATTTAAAAAATAGCTTTATAGAGTTTGTATGTTAGTCACTAG
CGTTTACGATGCAAATCAGAATAAATCTGAACGTAAAATTGCCTTTAATT
TTTCGGTAGGATTCGGTCGAATAATCCGCCTCAAGAAATGTTTGTCTAAC
CGTAATTTTGCTACTAAGACGTAGGCAATAGACACACGTACCTATTCTGT
AGCCCTCAGTAGGCCTTCAAGTCCAACCAAAGTCTAACGAATCGAAACAC
AAAACACAATACCGCGGCCTCATGCGACAGGGTTCTACGAGATATCTAGG
ACTTGGGCAAAGATCTT
back to top