HiSeq10093 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10093
Unique NameHiSeq10093
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length611
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10093 ID=HiSeq10093|Name=HiSeq10093|organism=Ostrinia scapulalis|type=mRNA|length=611bp
CACGGACACACACGACAAGTAGCCCTTCAAGTCCAACGAATCGAGATACA
ATATCGCGGTCTCATGCGACCACCTAGGGTTCTAAGATATCTAGGACTTG
GAAAAGGAATTCACAAGGAATTTCCTACGTAGGTAGTTATTAAGTACCCT
GGATTTAAGTTATTGGAGCTGTAGGCATAATATTTAGTAGATCCAAGAAA
TTAAAGTATTTATTTACCAACAAATTCTAGTAACGTAACTCACAAAATCT
CACAAGTACAAAATTACTGGATAGCCAGGATATGAGAAAGGTTGTGGATG
ATACACCAGGGGGCGCTCCAGACTTGCATTTTTTAATTCATGAGGATACA
GCTGCTTAGGCAAAGGAATTGGAGACTTGGCTACCTGAAAATTGAGATAT
TTCAGCCACCTCTGTTAGAATTTGAATAATAAAGAGAAATAAAATAGGTA
TTTTACCCACACAATCACAAACGAAAAACACTAACCAAATGTAAAAAATC
ATGTTATCTTTCAATCAACTTTATGTTGTGTGTGCAACTTTTACTGCCAA
ATAAAATTGAGATTGAATACATAGCATAGCAATTAAGTATTCAAAATCAA
ATTTCCTAGCT
back to top