HiSeq10094 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10094
Unique NameHiSeq10094
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length263
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10094 ID=HiSeq10094|Name=HiSeq10094|organism=Ostrinia scapulalis|type=mRNA|length=263bp
AACTTTCGCATTTATAATATTAGTGGGATTCGCATTAAAGTGCCCATATA
TCGATTGATAGTAGTTTACCATTAAAACATACTTATTTCACATTATAGGG
AAGGCTTACTGATTTATTTATTCTAAAATTATGTAAAATCTTGAGTATGC
CTACAAGATGAGATGTTTTGCGTGTTTTTGTTTAGGAATAAGTTAGTCAT
CTAGATTCTAATGAAGTTTTCTTAAGGTTACAAAATACTCTGGTCATCAC
AAAAATCGACCCT
back to top