HiSeq10100 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10100
Unique NameHiSeq10100
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length566
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10100 ID=HiSeq10100|Name=HiSeq10100|organism=Ostrinia scapulalis|type=mRNA|length=566bp
AAAAAATTATGTTAGATTTAGTTTTTATGCACATCTTAAAACCTGTTTGC
TTGTTCTAAAGTATAAATTTTTCGTTAATTTGAAAAAAAATTTTAGTTTT
TGAAAATAATAGTTTTGTAATGATACTTTAGTTCAAACTATCTTTCTTTA
AAATAAGTTTTGAATTCGTTCTGAAAATAAAAACGATACATGCGATTTTT
AATGATTTCATTCAATCTGTTAAATATTAAAATAAACAGTTTTTACATTA
TATTTTAATGTTTTTCTTCAACGCACACACTTCAGTGCAATATTCTCAGA
TATTATCATTAACTTTGTATATAAACACGATTACATAAACTATATTATCT
TTTAGCAAAACTTTCTTCCGTCTTAGATTAAAATTTTCTCACTCATATAA
TACCTTGAGTATTATTATTTATTTTGTAATATTTAGGTATTAAAACGATC
GTTTGAATACAATATTAGTTTTAAAGTCAAAAGTATACCACAATGTGGTA
TGTCATTATGTCACGAAGAATTCTAATAAAATGACAATCTATCGCCCGTA
TTCACAAACATTACTA
back to top