HiSeq10109 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10109
Unique NameHiSeq10109
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length273
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10109 ID=HiSeq10109|Name=HiSeq10109|organism=Ostrinia scapulalis|type=mRNA|length=273bp
GGTAAGATGGTGGTAGCTAGCCAGAATTTTTTAGGAATGTCATCATTATA
GTCACTTTCTCATGTCAGTTTTGCAAAAGGTCACTTTCTCAGAATGTCAT
TCACACCTTTTTCCTGTATACATATATGCGAAAGTGACCTAAAGCAAGTG
ACATTTTGAGAAAGTGACCATTTATTGGCAATGACATTTCGTGAAACGAC
GTTATGTATCAAAACCGTTTCAAATAATGCTTTGTCTAGTTCACCCTGCA
TAATCTGATCATAGAAACAGTTC
back to top