HiSeq10202 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10202
Unique NameHiSeq10202
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length873
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10202 ID=HiSeq10202|Name=HiSeq10202|organism=Ostrinia scapulalis|type=mRNA|length=873bp
ACAGTTACTACTATTTTCTATATTTTATACTATTTTCCGTATTTTATCAA
GTAAACTAGTTTTCAGTCAACCTTTGGACCATACAGAAATTACAGACTGA
AATGAATCATTTATCATTCGGTACTTTCATTCGTATGATTATTCCGACAT
CGTATGATTTTGTAGTTTATTTCCAGTCATTAGTTATTATCATAAATAAC
GTAAATTCGTATGATTAAGTTAATCCATTATCGTATGATTTCATAGTTTA
TTTTCAGTGGTTAATTTATCATTCGTAAATGACTAAAAATAAGTTATCTT
GACTAAAATAATTTATCTACCGCAATTTACAGGTGGATTTCTTTCTTTTG
AGGTTGCTATTTAACTTACACGTGTCATTAGTGTTGTACTGCTGTGGTGT
CATTACATAAAGTGCCATGAGTTCAACCGACCGATGCAAATCAGATGGAG
CCAATAAATCTTTATAGAATCACAAAATGTGATAGAAACGTGCGCGGACC
GAAGTGCCAGCGCGAGAGCGTGGGGCAGAACGTGATGTTGAACATTAAAA
TTTGCTATTTTTACCAAATCGTAGCTATAAATAAATTGTATGCTGGTTTA
ATTAATTAACAGTCTCTGCTAGTCGACCAGAAACTCATTGGCCTAACACA
AAGGTTTGAAAAGTTGACAACCTTTAGCTTTAGCGCTCATGACATTTAAT
CAATTTAGTCTAATTAATACTGTTGTCGGACAGTACGTTTGTTCGAGAAT
GACACAAATTACTAACAGTGTCGTTAACCCCTCGTGGTAAGCTAATTTAT
ACTTGTGTTACGAGTGGGTCCACCACAATACTCAAACGGCGGCGGGGGTT
CGAACCCGCGTTCCTCGGCCAGT
back to top