HiSeq10207 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10207
Unique NameHiSeq10207
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length204
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10207 ID=HiSeq10207|Name=HiSeq10207|organism=Ostrinia scapulalis|type=mRNA|length=204bp
TGGACCTTATTTCGTTGATAGAGAAGTTCAAAATGTAATATTGCCCATAT
TACATTTCTTGAGCACAGTTTGTTTTTTCTGGGTTTACTGCCTATAAGGC
AGTGGTTCTTAAGAACCACTGCTATAAGGCAATTGGCACAGTATTTTGAA
TCTTTCTCCCTTGTGTTAAGGTATAAAATCAATGAAAAATTATATTGCTA
TGAC
back to top