HiSeq1021 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq1021
Unique NameHiSeq1021
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length371
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq1021 ID=HiSeq1021|Name=HiSeq1021|organism=Ostrinia scapulalis|type=mRNA|length=371bp
AGCTCATCTGAGAATGGCCGAAAATACGTCTGGATATAGGGCATAGGCCT
CACCCTAACTGTGGGGTGTCTACGCTCTATCAGGCTGGCTCAGCTCAAAT
CTCCAATCTGCAGTACGATGCTAACACCACAGAATAATATGTAAAAAGTT
ACTAACACTATCGGGATATTATGTTCTATTTTTAATTGGATTTGTTTTTC
AAGTAAGCATGACAACAGTTAGCTTCCTAAAAATTGTTAAGAAAAATTCA
GTCTTCCATTGAGTGTCCACCTTCGTTGCTGCCTTCGTTTGAGAAAAACC
ATTTTGTTTGAGAGACGTTTAAGTCATTGTTATTGCGTGTTTCTCTCCTA
GAAGACACCTCTTCTTCAAAA
back to top