HiSeq10210 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10210
Unique NameHiSeq10210
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length715
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10210 ID=HiSeq10210|Name=HiSeq10210|organism=Ostrinia scapulalis|type=mRNA|length=715bp
CGCACCTCGTTAAAATGCGACTCTTCCTCGCACTTACCCGCTCACCTCCT
CGTGTTGTATGTTAACCAGAATTTGTTTTGTGACCCTATTTATTAAGAAA
CCCACTCCAATGATTATTAAGTTTTATGATGTCTACTTATTTGTTAATTA
TATTTATATGATATTTTTTGTATAACCTACGAGTATGCGCCTAAAAATGA
AGGAAGATATTTCAATATCAGTCTTTTTATTTTACTGTATTTACTTTTCT
ATGATTATGATAAATTTTATTGATCTTCGTTAGAAAATGAAAATACTTAT
TGTAAATTTATAATAATAGAATTCAAATATTGGTGCTTATACGAATAATA
ACTAAATTGCATTGGTTATACTCTTCCAAGCTTTCTTTCATACAATCAAT
AAATAGGCAAATAGATGTATATAATTAGTTGATTTGTATAAATTATATAG
TTAAAAGATTTCTTGGATCGACAGTAGAAAAGAAATAGTGGAATTTTACA
TTTTCATTGAAGACAATGGCTCTATAATATAAATTAAATATTATATAAAA
TGTATAAATGTAAATATTAGGTAAACAAATTATGTATATGAGAATAATAA
TTAAATTATATTATTAATAAAATATGGTCAAGTAAAGAGAGAATGCTAGA
TGGACCAAATCGGGGTGAATGAATTGTGTATATTAAAAGGTGTAATTAAT
AAATACAATTTGAAA
back to top