HiSeq10211 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10211
Unique NameHiSeq10211
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length853
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10211 ID=HiSeq10211|Name=HiSeq10211|organism=Ostrinia scapulalis|type=mRNA|length=853bp
GGACCGACGATCTGGTGAAGGTCCTGGGAAGCACCTGAATGCGGGCATCG
CAGGCAGGACTGGTTGTTGTGGAAATAATTGAGAGAAACATTTGTCCAGC
TATGAGTATATTTTAGTAGAAACGAATATTATAATAATTGATGGCTATTA
TAGATATGTAAAATTACTTCTCGTACCTGTTAATTTTATGTACCAAAGAA
AAATACAACTTTCCTTTGCATATGATGTAGGTATTATTTATTGATGTAAT
TGTTTGATAGTTTTTATAATATGTTACGGTTTCGTTAAGGTTTAATGTGA
AAAATATTATATCTTGTAATATATTTTTCACACGTGTAAAGGGTTTTCTA
TGTACTATGTATAATCTTTAATGCTTAATGTCTATGTAGTATAAGCATGA
AAACTGTATTTCAGCTTGTAATGCAAATATTTGTGTATTATTGTTCATCT
GATGTCATAATATAAATAGAATGAACTTTCCAAGTCCATTACGAATACAT
AATGTATATTTTTGTAAAGAAATATATACCCAGTTCAACAAATAAATACA
ATATAAGTAGGTATTCTTAATAAATGTCTATTTCTACCTCGATTCGGTTT
TGCAGGCAAAAGCCCTCATAAAAAATATACTATTTAGAGTGGTTAGGTAT
TCTGTAACAGGAACCATACCTATTTGTATAATATGAATGAATGACGAAGT
ACTTAAAGTATTAAATAAATGTATTCCATTTGTATGATAGAATGTTACAT
GAAAAATCTTAAACAGTGTTAAGCATGATATAGATAGATAGAATATATAT
ATAATTAATTGATTACTGATATGCAATTGAATATGAGATTCTAATTCGTT
TAA
back to top