HiSeq1022 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq1022
Unique NameHiSeq1022
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length384
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq1022 ID=HiSeq1022|Name=HiSeq1022|organism=Ostrinia scapulalis|type=mRNA|length=384bp
AAGGAATGCATTGGCATCTTCAAATCGGGAGAAAGCCAAAGAAATTCGAT
TTCTACCTATTTTTTTCATGCTACCATCAACAATGCCTCTTATAGACTTT
CGTTTAAGGAAATGCCCTACTGTTACAGGGTGCAGAGTACAATTTTCATT
TGGCATAGTTTGTTCTTTTTGTATATGAACAACATAAGGTGCAACATCAG
TAGCCTCATATAAGTTTCTACTTGTCGAGTAAGGTGGTGTTGAATCAGAT
GTGTGGGACTGAGAAGCAGCAGGAGTAGATGGGGTAACAAAAGAATTCTC
TTTTTCAACAACTTTCGGAGCACTATTAACATTCTCAGTGTTTGTACAAC
AACAATCAGTATCATTAGGTACCTGGCTCAATGT
back to top