HiSeq10220 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10220
Unique NameHiSeq10220
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length918
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10220 ID=HiSeq10220|Name=HiSeq10220|organism=Ostrinia scapulalis|type=mRNA|length=918bp
CTGCCAAAAATGGCTGCAAATATACTTTCATTTCCAAAATACCCCCGGCG
GACATGGGGAAAATAAATGACGACGTGCAACTCCATCCATTGCCTGGTAT
TATGCATGAGAAACTGTCTTCGTGAGGGCTGTCTATTGCTAACATTGAAT
AGTTCCTCAATAGCCAATTGGTAGAATATCTACAAACTCCATCACTCGAA
AATAAGGTATTATAATCTTGACCGAACTGGTAAGTAACACATCCATCCTC
CTCCGAATCTGGTTCTTCTACTTCGGGGGTAGTTGAAGCTTCATTGGCTT
CTGTGGTCGGAGATATAACGGGTGTTTCATCGTACACGATACAAAGACTT
TCATCAACGGTAGGAGGAATATAGCGAAATGAATCTACTATAACCAAAGA
TCTTATAGCAACTTGTCCCATTATAGTCACCTGTCCATCGTAATCGCCGT
CCCCGGCCAACTGTATCCTTAAAGTGCTCCATCCAAACTGGCGATCAGAT
GCAGCTGAGCCAACCACCAAGTCAGTTCCAAGTGAATTTATCTGATAGAC
TGTTACAAGCACTCTGTCTGTCGCCGAAAACGGCTCCAAGTATACTTCCA
CTTCTAAAATACCCCCGGCGGACATAGGGAAGGTAAATGACGATGTACAA
CTCCATCCGTTGCCTGGTATTATGCATGAGACACTGTTTTTGTGAGGGCT
GTCTATTGTTAATGAAGTGTAGTTTCTCAGTAACCAATTGGCGGAATATC
TACAAACGCCATCATTCGAAAATAAGCTGTTGAAATCTTGACCGAACTGG
TAAGTGACACATCCAGCGCCAGGATTCTCGTTAGATTCAGAATCAGGATC
AGTCTCGTTGGAGTCGGAAGTACCAGGATAACTTTCAGTAGATCCAGTGC
CAACAGTAGACTCATTAG
back to top