HiSeq10221 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10221
Unique NameHiSeq10221
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length354
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10221 ID=HiSeq10221|Name=HiSeq10221|organism=Ostrinia scapulalis|type=mRNA|length=354bp
GGGTGAATTATTTAATAAAAACTTCAAACGTAGTTAAAAAACGATGTATT
TGAAGTCATAGATAAATCAATATGAATTAAACTTAGCATGAATCATTGTT
TTACAAATACTAGTTGTAAATCTTACAGTTTTCTTCATTCGATGAGGGTG
GAATGTACCTGAATGAATCTACTAAGACGACCGACCTTATTGCGACCTGT
CCCATAATTGTAATCTGTCCATCGAAGTCGCCGTCTCCAGCCAACTGTAT
CCTTAAAGTGCTCCATCCAAACTGGCGATCAGTTCCAGCTGAGCCAACCA
CCAAGTCAGTTCCAAGTGAATTTATCTGATAGACTGTTACAAGCACTCTG
TCTG
back to top